TMED4 (NM_001303058) Human Untagged Clone

CAT#: SC334288

TMED4 (untagged) - Human transmembrane emp24 protein transport domain containing 4 (TMED4), transcript variant 2



  "NM_001303058" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-TMED4 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ERS25; GMP25iso; HNLF; p24a3; p24alpha3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303058, the custom clone sequence may differ by one or more nucleotides


ATGGCAGGTGTCGGGGCTGGGCCTCTGCGGGCGATGGGGCGGCAGGCCCTGCTGCTTCTCGCGCTGTGCG
CCACAGGCGCCCAGGGGCTCTACTTCCACATCGGCGAGACCGAGAAGCGCTGTTTCATCGAGGAAATCCC
CGACGAGACCATGGTCATCGGCAACTATCGTACCCAGATGTGGGATAAGCAGAAGGAGGTCTTCCTGCCC
TCGACCCCTGGCCTGGGCATGCACGTGGAAGTGAAGGACCCCGACGGCAAGGTGGTGCTGTCCCGGCAGT
ACGGCTCGGAGGGCCGCTTCACGTTCACCTCCCACACGCCCGGTGACCATCAAATCTGTCTGCACTCCAA
TTCTACCAGGATGGCTCTCTTCGCTGGTGGCAAACTGCGGGTGCATCTCGACATCCAGGTTGGGGAGCAT
GCCAACAACTACCCTGAGATTGCTGCAAAAGATAAGCTGACGGAGCTACAGCTCCGCGCCCGCCAGTTGC
TTGATCAGGTGGAACAGATTCAGAAGGAGCAGGATTACCAAAGGGCAAGTGCATATCTCCTTGTAATTTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001303058
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303058.1, NP_001289987.1
RefSeq Size 1837 bp
RefSeq ORF 561 bp
Locus ID 222068
UniProt ID Q7Z7H5
Protein Families Transmembrane
Gene Summary Involved in vesicular protein trafficking, mainly in the early secretory pathway. targeting. Involved in the maintenance of the Golgi apparatus. Appears to play a role in the biosynthesis of secreted cargo including processing. Involved in endoplasmic reticulum stress response. May play a role in the regulation of heat-shock response and apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...