TFPI2 (NM_001271004) Human Untagged Clone
CAT#: SC334285
TFPI2 (untagged) - Human tissue factor pathway inhibitor 2 (TFPI2), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
TFPI2 mouse monoclonal antibody, clone OTI1D4 (formerly 1D4)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PP5; REF1; TFPI-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001271004, the custom clone sequence may differ by one or more nucleotides
ATGGACCCCGCTCGCCCCCTGGGGCTGTCGATTCTGCTGCTTTTCCTGACGGAGGCTGCACTGGGCGATG CTGCTCAGGAGCCAACAGGAAATAACGCGGAGATCTGTCTCCTGCCCCTAGACTACGGACCCTGCCGGGC CCTACTTCTCCGTTACTACTACGACAGGTACACGCAGAGCTGCCGCCAGTTCCTGTACGGGGGCTGCGAG GGCAACGCCAACAATTTCTACACCTGGGAGGCTTGCGACGATGCTTGCTGGAGGATAGAAAAAGTTCCCA AAGTTTGCCGGCTGCAAGTGAGTGTGGACGACCAGTGTGAGGGGTCCACAGAAAAGTATTTCTTTAATCT AAGTTCCATGACATGTGAAAAATTCTTTTCCGGTGGGTGTCACCGGAACCGGATTGAGAACAGGTTTCCA GATGAAGCTACTTGTATGGGCTTCTGCGCACCAAAGAAAAATACAGAACCTGTGATGCTTTCACCTATAC TGGCTGTGGAGGGAATGACAATAACTTTGTTAGCAGGGAGGATTGCAAACGTGCATGTGCAAAAGCTTTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271004 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271004.1, NP_001257933.1 |
RefSeq Size | 2368 bp |
RefSeq ORF | 561 bp |
Locus ID | 7980 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (3) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...