CLRN1 (NM_001256819) Human Untagged Clone
CAT#: SC334273
CLRN1 (untagged) - Human clarin 1 (CLRN1), transcript variant 6
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RP61; USH3; USH3A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001256819, the custom clone sequence may differ by one or more nucleotides
ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAG TTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCGT CAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAGGGT GTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATGCTATTTTCTTGACCCCTTCATGGGAC TCCCAACAGGGGTACCCCATTTACTCAGCCTGCCCTGCTCAACCTCTTGCAGGAGGGAGCACACGAGTGA ACGAGTGCAGGAACCAGCTGGCTGCTTTAGTGCTGTGAGGAGTAAACTCCATGCAGGCCCTGCAGCAGCA ACCAGTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCC ATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAACCTTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256819 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001256819.1, NP_001243748.1 |
RefSeq Size | 2531 bp |
RefSeq ORF | 558 bp |
Locus ID | 7401 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) has multiple differences in the coding region, compared to variant 5, one of which results in a translational frameshift. The resulting isoform (e) has a distinct C-terminus and is shorter than isoform d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...