NCE2 (UBE2F) (NM_001278305) Human Untagged Clone
CAT#: SC334266
UBE2F (untagged) - Human ubiquitin-conjugating enzyme E2F (putative) (UBE2F), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images
推荐一起购买 (4)
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NCE2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001278305, the custom clone sequence may differ by one or more nucleotides
ATGCTAACGCTAGCAAGTAAACTGAAGCGTGACGATGGTCTCAAAGGGTCCCGGACGGCAGCCACAGCGT CCGACTCGACTCGGAGGGTTTCTGTGAGAGACAAATTGCTTGTTAAAGAGGTTGCAGAACTTGAAGCTAA TTTACCTTGTACATGTAAAGTGCATTTTCCTGATCCAAACAAGCTTCATTGTTTTCAGCTAACAGTAACC CCAGATGAGGGTTACTACCAGGGTGGAAAATTTCAGTTTGAAACTGAAGTTCCCGATGCGTACAACATGG TGCCTCCCAAAGTGAAATGCCTGACCAAGATCTGGCACCCCAACATCACAGAGACAGGGGAAATATGTCT GAGTTTATTGAGAGAACATTCAATTGATGGCACTGGCTGGGCTCCCACAAGAACATTAAAGGATGTCGTT TGGGGATTAAACTCTTTGTTTACTGATCTTTTGAATTTTGATGATCCACTGAATATTGAAGCTGCAGAAC ATCATTTGCGGGACAAGGAGGACTTCCGGAATAAAGTGGATGACTACATCAAACGTTATGCCAGATGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001278305 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001278305.1, NP_001265234.1 |
| RefSeq Size | 2135 bp |
| RefSeq ORF | 558 bp |
| Locus ID | 140739 |
| UniProt ID | Q969M7 |
| Protein Pathways | Ubiquitin mediated proteolysis |
| Gene Summary | Accepts the ubiquitin-like protein NEDD8 from the UBA3-NAE1 E1 complex and catalyzes its covalent attachment to other proteins. The specific interaction with the E3 ubiquitin ligase RBX2, but not RBX1, suggests that the RBX2-UBE2F complex neddylates specific target proteins, such as CUL5.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
Customer
Reviews
Loading...
