MOBP (NM_001278323) Human Untagged Clone
CAT#: SC334259
MOBP (untagged) - Human myelin-associated oligodendrocyte basic protein (MOBP), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278323, the custom clone sequence may differ by one or more nucleotides
ATGAGTCAGAAACCGGCCAAGGAGGGTCCCAGACTCTCCAAAAACCAGAAGTACTCCGAACACTTCAGCA TACACTGCTGCCCGCCGTTCACCTTCCTCAATTCCAAGAAGGAGATAGTGGATCGGAAATACAGCATCTG TAAGAGCGGCTGCTTCTACCAGAAGAAAGAGGAGGACTGGATCTGCTGCGCCTGCCAGAAGACCAGAACC AGCCGCCGTGCCAAGTCCCCTCAGAGGCCCAAGCAACAGCCAGCTGCGCCCCCCGCGGTGGTCAGAGCGC CAGCCAAGCCACGGTCCCCTCCGAGGTCTGAGCGTCAGCCACGGTCCCCTCCGAGGTCTGAGCGTCAGCC ACGGTCCCCTCCGAGGTCTGAGCGTCAGCCACGGTCCCCTCCGAGGTCTGAGCGTCAGCCACGTCCCCGC CCAGAGGTCCGACCACCGCCAGCCAAGCAGCGTCCCCCTCAGAAGTCCAAGCAACAGCCGCGCAGCAGCC CCCTCAGAGGGCCAGGCGCCAGCCGTGGGGGGTCCCCCGTCAAAGCTTCTAGGTTCTGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278323 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278323.1, NP_001265252.1 |
RefSeq Size | 703 bp |
RefSeq ORF | 552 bp |
Locus ID | 4336 |
UniProt ID | Q13875 |
Gene Summary | May play a role in compacting or stabilizing the myelin sheath, possibly by binding the negatively charged acidic phospholipids of the cytoplasmic membrane.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains multiple differences in the UTRs and coding region, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...