TRAF3IP3 (NM_001287754) Human Untagged Clone
CAT#: SC334246
TRAF3IP3 (untagged) - Human TRAF3 interacting protein 3 (TRAF3IP3), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | T3JAM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287754, the custom clone sequence may differ by one or more nucleotides
ATGAAAAAAGTACTACTGGAGATGGAAGACCAGAAAAACAGCTATGAGCAGAAGGCCAAGGAGTCACTGC AGAAAGTGCTGGAGGAGAAAATGAATGCAGAGCAGCAACTACAGAGCACACAGCGATCCCTGGCCCTGGC AGAGCAGAAGTGTGAAGAGTGGAGGAGCCAGTATGAGGCTCTGAAGGAGGACTGGAGGACCCTTGGGACC CAGCACAGGGAGCTGGAGAGCCAACTCCACGTGCTTCAGTCCAAACTGCAGGGAGCAGATAGCAGGGACT TACAGATGAACCAGGCCCTGCGATTTTTGGAAAATGAGCACCAGCAACTGCAGGCCAAGATTGAATGCCT GCAAGGGGACAGAGACCTGTGCAGCTTGGATACCCAGGACCTACAAGATCAACTAAAAAGGTCAGAGGCA GAGAAACTCACCCTGGTGACCAGAGTACAGCAGTTGCAGGGTTTGCTTCAAAATCAATCCTTACAGCTTC AAGAACAGGAGAAACTCTTAACAAAGAAAGGTCAGCAAATTTATTACCACAAATTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287754 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001287754.1, NP_001274683.1 |
RefSeq Size | 1083 bp |
RefSeq ORF | 549 bp |
Locus ID | 80342 |
UniProt ID | Q9Y228 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (2) lacks several exons, uses an alternate 5'-terminal exon, initiates translation at a downstream start codon, and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (2) has a shorter N-terminus and a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它TRAF3IP3产品
Customer
Reviews
Loading...