MED6 (NM_001284210) Human Untagged Clone
CAT#: SC334230
MED6 (untagged) - Human mediator complex subunit 6 (MED6), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
MED6 mouse monoclonal antibody, clone OTI3B9 (formerly 3B9)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARC33; NY-REN-28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001284210, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATTT TGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAATAA TGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATCCTT TTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTTATCC CACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATAAACTC TAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGATATCAT CCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGCTAAAGCCTGGAGAAAAGCCTGTT CCAGTGGATCAAACAAAGAAAGAGGCAGAACCTATACCAGAAACTGTAAAACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284210 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001284210.1, NP_001271139.1 |
RefSeq Size | 2270 bp |
RefSeq ORF | 546 bp |
Locus ID | 10001 |
UniProt ID | O75586 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site and lacks an alternate exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...