NBL1 (NM_001278166) Human Untagged Clone

CAT#: SC334221

NBL1 (untagged) - Human neuroblastoma 1, DAN family BMP antagonist (NBL1), transcript variant 8



  "NM_001278166" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-NBL1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D1S1733E; DAN; DAND1; NB; NO3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278166, the custom clone sequence may differ by one or more nucleotides


ATGATGCTTCGGGTCCTGGTGGGGGCTGTCCTCCCTGCCATGCTACTGGCTGCCCCACCACCCATCAACA
AGCTGGCACTGTTCCCAGATAAGAGTGCCTGGTGCGAAGCCAAGAACATCACCCAGATCGTGGGCCACAG
CGGCTGTGAGGCCAAGTCCATCCAGAACAGGGCGTGCCTAGGACAGTGCTTCAGCTACAGCGTCCCCAAC
ACCTTCCCACAGTCCACAGAGTCCCTGGTTCACTGTGACTCCTGCATGCCAGCCCAGTCCATGTGGGAGA
TTGTGACGCTGGAGTGCCCGGGCCACGAGGAGGTGCCCAGGGTGGACAAGCTGGTGGAGAAGATCCTGCA
CTGTAGCTGCCAGGCCTGCGGCAAGGAGCCTAGTCACGAGGGGCTGAGCGTCTATGTGCAGGGCGAGGAC
GGGCCGGGATCCCAGCCCGGCACCCACCCTCACCCCCATCCCCACCCCCATCCTGGCGGGCAGACCCCTG
AGCCCGAGGACCCCCCTGGGGCCCCCCACACAGAGGAAGAGGGGGCTGAGGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278166
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278166.1, NP_001265095.1
RefSeq Size 1971 bp
RefSeq ORF 546 bp
Locus ID 4681
UniProt ID P41271
Protein Families Secreted Protein
Gene Summary This gene product is the founding member of the evolutionarily conserved CAN (Cerberus and DAN) family of proteins, which contain a domain resembling the CTCK (C-terminal cystine knot-like) motif found in a number of signaling molecules. These proteins are secreted, and act as BMP (bone morphogenetic protein) antagonists by binding to BMPs and preventing them from interacting with their receptors. They may thus play an important role during growth and development. Alternatively spliced transcript variants have been identified for this gene. Read-through transcripts between this locus and the upstream mitochondrial inner membrane organizing system 1 gene (GeneID 440574) have been observed. [provided by RefSeq, May 2013]
Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2, 3, 4, 6, 7, and 8 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...