MRCL3 (MYL12A) (NM_001303049) Human Untagged Clone
CAT#: SC334193
MYL12A (untagged) - Human myosin, light chain 12A, regulatory, non-sarcomeric (MYL12A), transcript variant 4
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL-S-24; MLC-2B; MLCB; MRCL3; MRLC3; MYL2B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303049, the custom clone sequence may differ by one or more nucleotides
ATGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAA CATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGA TCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCA ACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCA TGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGA AGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACA GATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGT TCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303049 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001303049.1, NP_001289978.1 |
RefSeq Size | 981 bp |
RefSeq ORF | 534 bp |
Locus ID | 10627 |
UniProt ID | O14950 |
Protein Pathways | Focal adhesion, Leukocyte transendothelial migration, Regulation of actin cytoskeleton, Tight junction |
Gene Summary | This gene encodes a nonsarcomeric myosin regulatory light chain. This protein is activated by phosphorylation and regulates smooth muscle and non-muscle cell contraction. This protein may also be involved in DNA damage repair by sequestering the transcriptional regulator apoptosis-antagonizing transcription factor (AATF)/Che-1 which functions as a repressor of p53-driven apoptosis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8.[provided by RefSeq, Dec 2014] Transcript Variant: This variant (4) uses an alternate exon in the 5' UTR and 5' coding region compared to variant 1. These differences result in the use of an alternate start codon compared to variant 1. The encoded isoform (2) has a longer N-terminus compare to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...