Alpha B Crystallin (CRYAB) (NM_001289807) Human Untagged Clone
CAT#: SC334180
CRYAB (untagged) - Human crystallin, alpha B (CRYAB), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
CRYAB (Alpha B Crystallin) mouse monoclonal antibody, clone OTI6D11 (formerly 6D11)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CMD1II; CRYA2; CTPP2; CTRCT16; HEL-S-101; HSPB5; MFM2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001289807, the custom clone sequence may differ by one or more nucleotides
ATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTTTCCTTTCCACTCCCCCAGCCGCCTCT TTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCGACGTCTACTTCCCTGAGTCCCTT CTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGTTTGACACTGGACTCTCAGAGATGCGCCTG GAGAAGGACAGGTTCTCTGTCAACCTGGATGTGAAGCACTTCTCCCCAGAGGAACTCAAAGTTAAGGTGT TGGGAGATGTGATTGAGGTGCATGGAAAACATGAAGAGCGCCAGGATGAACATGGTTTCATCTCCAGGGA GTTCCACAGGAAATACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTCATCCCTGTCATCTGAT GGGGTCCTCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCCCATCACCCGTG AAGAGAAGCCTGCTGTCACCGCAGCCCCCAAGAAATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289807 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001289807.1, NP_001276736.1 |
RefSeq Size | 964 bp |
RefSeq ORF | 528 bp |
Locus ID | 1410 |
UniProt ID | P02511 |
Gene Summary | Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha crystallins are composed of two gene products: alpha-A and alpha-B, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. These heterogeneous aggregates consist of 30-40 subunits; the alpha-A and alpha-B subunits have a 3:1 ratio, respectively. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Alpha-A and alpha-B gene products are differentially expressed; alpha-A is preferentially restricted to the lens and alpha-B is expressed widely in many tissues and organs. Elevated expression of alpha-B crystallin occurs in many neurological diseases; a missense mutation cosegregated in a family with a desmin-related myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2019] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Alpha B Crystallin产品
Customer
Reviews
Loading...