FAM107A (NM_001282713) Human Untagged Clone
CAT#: SC334155
FAM107A (untagged) - Human family with sequence similarity 107, member A (FAM107A), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DRR1; TU3A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282713, the custom clone sequence may differ by one or more nucleotides
ATGGCGCAGAGGCTGGGCGAGTGGGCCCGGGGGCCCTCCGATGCCACCGGGCTCTACCGGGCTGTGCTGC TCCGGTCGGCCGCCATGTACTCGGAGATCCAGAGGGAGCGGGCAGACATTGGGGGCCTGATGGCCCGGCC AGAATACAGAGAGTGGAATCCGGAGCTCATCAAGCCCAAGAAGCTGCTGAACCCCGTGAAGGCCTCTCGG AGTCACCAGGAGCTCCACCGGGAGCTGCTCATGAACCACAGAAGGGGCCTTGGTGTGGACAGCAAGCCAG AGCTGCAGCGTGTCCTAGAGCACCGCCGGCGGAACCAGCTCATCAAGAAGAAGAAGGAGGAGCTGGAAGC CAAGCGGCTGCAGTGCCCCTTTGAGCAGGAGCTGCTGAGACGGCAGCAGAGGCTGAACCAGCTGGAAAAA CCACCAGAGAAGGAAGAGGATCACGCCCCCGAGTTTATTAAAGTCAGGGAAAACCTGCGGAGAATTGCCA CACTGACCAGCGAAGAGAGAGAGCTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282713 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282713.1, NP_001269642.1 |
RefSeq Size | 3190 bp |
RefSeq ORF | 519 bp |
Locus ID | 11170 |
UniProt ID | O95990 |
Gene Summary | Stress-inducible actin-binding protein that plays a role in synaptic and cognitive functions by modulating actin filamentous (F-actin) dynamics. Mediates polymerization of globular actin to F-actin. Also binds to, stabilizes and bundles F-actin. Involved in synaptic function by regulating neurite outgrowth in an actin-dependent manner and for the acquisition of hippocampus-dependent cognitive function, such as learning and long-term memory (By similarity). Plays a role in the actin and microtubule cytoskeleton organization; negatively regulates focal adhesion (FA) assembly promoting malignant glial cell migration in an actin-, microtubule- and MAP1A-dependent manner (PubMed:20543869). Also involved in neuroblastoma G1/S phase cell cycle progression and cell proliferation inhibition by stimulating ubiquitination of NF-kappa-B subunit RELA and NF-kappa-B degradation in a COMMD1- and actin-dependent manner (PubMed:10564580, PubMed:28604741). May play a role in tumor development (PubMed:10564580).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b) has a longer N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
其它FAM107A产品
Customer
Reviews
Loading...