RNF86 (TRIM2) (NM_001302692) Human Untagged Clone

CAT#: SC334085

TRIM2 (untagged) - Human tripartite motif containing 2 (TRIM2), transcript variant 3



  "NM_001302692" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TRIM2 mouse monoclonal antibody, clone OTI2B10 (formerly 2B10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMT2R; RNF86
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334085 representing NM_001302692.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACAGGAGTGGCCGTTATGGAACGCAGCAGCAGCGTGCAGGGTCAAAGACAGCCGGCCCCCCATGT
CAGTGGTCTAGGATGGCCAGTGAAGGCACCAACATCCCAAGTCCTGTGGTGCGCCAGATTGACAAGCAG
TTTCTGATTTGCAGTATATGCCTGGAACGGTACAAGAATCCCAAGGTTCTCCCCTGTCTGCACACTTTC
TGCGAGAGGTGCCTGCAGAACTACATTCCTGCCCACAGTTTAACCCTCTCCTGCCCAGTGTGCCGCCAG
ACCTCCATCCTGCCCGAGAAAGGGGTGGCCGCGCTCCAGAACAATTTCTTCATCACAAACCTGATGGAC
GTGCTGCAGCGAACTCCAGGCAGCAACGCTGAGGAGTCTTCCATCCTGGAGACAGTCACTGCTGTGGCT
GCGGGAAAGCCTCTCTCTTGCCCAAACCACGATGGGAATGTAAGTGGCTGGGATGGCAGATACTGCCCG
GGAGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302692
Insert Size 492 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302692.1
RefSeq Size 729 bp
RefSeq ORF 492 bp
Locus ID 23321
MW 17.8 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (3) lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...