SURF4 (NM_001280789) Human Untagged Clone

CAT#: SC334059

SURF4 (untagged) - Human surfeit 4 (SURF4), transcript variant 3



  "NM_001280789" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SURF4 Rabbit polyclonal Antibody
    • 100 ul

CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ERV29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334059 representing NM_001280789.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCAGAACGACCTGATGGGCACGGCCGAGGACTTCGCCGACCAGTTCCTCCGTGTCACAAAGCAG
TACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTGGAGGACGGCATCCGTATGTGGTTC
CAGTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCCTCGTCCTTC
GTCTTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTCGTGCAGTAC
GCCTGCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGGGACTTGAAG
TTTTTGATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTCCTAGCAGAATCCCGTTCTGAAGGG
AAGAGCATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCCAAACAGTACCTGCCTGGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001280789
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001280789.1
RefSeq Size 2709 bp
RefSeq ORF 480 bp
Locus ID 6836
UniProt ID O15260
Protein Families Transmembrane
MW 18 kDa
Gene Summary This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) uses two alternate splice sites in its 3' coding region, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...