NDUFB8 (NM_001284368) Human Untagged Clone
CAT#: SC334008
NDUFB8 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa (NDUFB8), transcript variant 3
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASHI; CI-ASHI; MC1DN32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334008 representing NM_001284368.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCAAGGACATGTTCCCGGGGCCCTATCCTAGGACCCCAGAAGAACGGGCCGCCGCCGCCAAGAAG TATAATATGCGTGTGGAAGACTACGAACCTTACCCGGATGATGGCATGGGGTATGGCGACTACCCGAAG CTCCCTGACCGCTCACAGCATGAGAGAGATCCATGGTATAGCTGGGACCAGCCGGGCCTGAGGTTGAAC TGGGGTGAACCGATGCACTGGCACCTAGACATGTACAACAGGAACCGTGTGGATACATCCCCCACACCT GTTTCTTGGCATGTCATGTGTATGCAGCTCTTCGGTTTCCTGGCTTTCATGATATTCATGTGCTGGGTG GGGGACGTGTACCCTGTCTACCAGCCTGTGGGACCAAAGCAGTATCCTTACAATAATCTGTACCTGGAA CGAGGCGGTGATCCCTCCAAAGAACCAGAGCGGGTGGTTCACTATGAGATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284368 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001284368.1 |
RefSeq Size | 667 bp |
RefSeq ORF | 468 bp |
Locus ID | 4714 |
UniProt ID | O95169 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 18.5 kDa |
Gene Summary | Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site in the 5' terminal exon, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236114 | NDUFB8 (myc-DDK-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa (NDUFB8), transcript variant 3 |
CNY 3990.00 |
|
RG236114 | NDUFB8 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa (NDUFB8), transcript variant 3 |
CNY 4370.00 |