CDIPT (NM_001286586) Human Untagged Clone

CAT#: SC333953

CDIPT (untagged) - Human CDP-diacylglycerol--inositol 3-phosphatidyltransferase (CDIPT), transcript variant 3



  "NM_001286586" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CDIPT Antibody - C-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PIS; PIS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333953 representing NM_001286586.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGACATGCTGACGGACCGCTGCTCCACCATGTGCCTGTTGGTCAACCTGGCCCTGCTGTACCCT
GGAGCCACGCTGTTCTTCCAAATCAGCATGAGTTTGGATGTGGCCAGTCACTGGCTGCACCTCCACAGT
TCTGTGGTCCGAGGCAGTGAGAGTCACAAGATGATCGACTTGTCCGGGAATCCGGTGCTTCGGATCTAC
TACACCTCGAGGCCTGCTCTGTTCACCTTGTGTGCTGGGAATGAGCTCTTCTACTGCCTCCTCTACCTG
TTCCATTTCTCTGAGGGACCTTTAGTTGGCTCTGTGGGACTGTTCCGGATGGGCCTCTGGGTCACTGCC
CCCATCGCCTTGCTGAAGTCGCTCATCAGCGTCATCCACCTGATCACGGCCGCCCGCAACATGGCTGCC
CTGGACGCAGCAGACCGCGCCAAGAAGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286586
Insert Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286586.1
RefSeq Size 1843 bp
RefSeq ORF 447 bp
Locus ID 10423
Protein Families Transmembrane
Protein Pathways Glycerophospholipid metabolism, Inositol phosphate metabolism, Metabolic pathways, Phosphatidylinositol signaling system
MW 16.4 kDa
Gene Summary Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (3) uses an alternate splice junction at the 5' end of an exon and initiates translation at a downstream AUG compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...