CEBP Beta (CEBPB) (NM_001285879) Human Untagged Clone

CAT#: SC333947

CEBPB (untagged) - Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB), transcript variant 1



  "NM_001285879" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CEBPB Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C/EBP-beta; IL6DBP; NF-IL6; TCF5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333947 representing NM_001285879.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGGGCTTCCCGTACGCGCTGCGCGCTTACCTCGGCTACCAGGCGGTGCCGAGCGGCAGCAGC
GGGAGCCTCTCCACGTCCTCCTCGTCCAGCCCGCCCGGCACGCCGAGCCCCGCTGACGCCAAGGCGCCC
CCGACCGCCTGCTACGCGGGGGCCGCGCCGGCGCCCTCGCAGGTCAAGAGCAAGGCCAAGAAGACCGTG
GACAAGCACAGCGACGAGTACAAGATCCGGCGCGAGCGCAACAACATCGCCGTGCGCAAGAGCCGCGAC
AAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGGTCCTGGAGCTCACGGCCGAGAACGAGCGGCTG
CAGAAGAAGGTGGAGCAGCTGTCGCGCGAGCTCAGCACCCTGCGGAACTTGTTCAAGCAGCTGCCCGAG
CCCCTGCTCGCCTCCTCCGGCCACTGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001285879
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285879.1
RefSeq Size 2113 bp
RefSeq ORF 444 bp
Locus ID 1051
UniProt ID P17676
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
MW 15.9 kDa
Gene Summary This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform [c, also known as LIP (liver inhibitory protein)] represented in this RefSeq results from translation initiation at a downstream AUG start codon. Isoform c has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...