COA8 (NM_001302654) Human Untagged Clone

CAT#: SC333932

APOPT1 (untagged) - Human apoptogenic 1, mitochondrial (APOPT1), transcript variant 4



  "NM_001302654" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-APOPT1 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APOP; APOP1; APOPT1; C14orf153; MC4DN17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333932 representing NM_001302654.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCCGTGCGCCGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCGGGCGGGGAAGAAGACC
TTTCTCCCCCCTCTCTGCCGCGCCTTCGCCTGCCGCGGCTGTCAACTCGCTCCGGAGCGCGGCGCCGAG
CGCAGGGATACGGCGCCCAGCGGGGTCTCAAGATTCTGCCCTCCAAGAAAGTCTTGCCATGATTGGATA
GGACCCCCAGATAAATATTCAAACCTTCGACCTGTTCACTTTTACATACCTGAAAATGAATCTCCATTG
GAACAAAAGCTTAGAAAATTAAGACAAGAAACACAAGAATGGAATCAACAGTTCTGGGCAAACCAGAAT
TTGACTTTTAGTAAGGAAAAAGAAGAATTTATTCACTCAAGACTAAAAACTAAAGGCCTGGGCCTGAGA
ACTGAATCAGGTGGTTATGATGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302654
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302654.1
RefSeq Size 787 bp
RefSeq ORF 441 bp
Locus ID 84334
Protein Families Secreted Protein
MW 16.6 kDa
Gene Summary This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (4) lacks multiple 3' exons and contains an alternate 3' terminal exon, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct, shorter C-terminus than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...