CST8 (NM_001281730) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CRES; CTES5
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333889 representing NM_001281730. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCCAGGTGCCGGTGGCTCTCCCTGATCCTCCTCACCATTCCCCTGGCCCTGGTGGCCAGGAAAGAC CCAAAAAAGAATGAGACAGGGGTGCTGAGGAAATTAAAACCCGTCAATGCCTCAAATGCCAACGTGAAG CAGTGTCTGTGGTTTGCCATGCAAGAATACAACAAAGAGAGCGAGGACAAGTATGTCTTCCTGGTGGTC AAGACACTGCAAGCCCAGCTTCAGGTCACAAATCTTCTGGAATACCTTATTGATGTAGAAATTGCCCGC AGCGATTGCAGAAAGCCTTTAAGCACTAATGAAATCTGCGCCATTCAAGAAAACTCCAAGCTGAAAAGG AAATTAAGCTGCAGCTTTTTGGTAGGAGCACTTCCCTGGAATGGTGAATTCACTGTGATGGAGAAAAAG TGTGAAGATGCTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001281730
Insert Size	429 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001281730.1
RefSeq Size	764 bp
RefSeq ORF	429 bp
Locus ID	10047
UniProt ID	O60676
Protein Families	Secreted Protein
MW	16.3 kDa
Gene Summary	The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to type 2 cystatins. The encoded protein exhibits highly tissue-specific expression in the reproductive tract, suggesting implicit roles in reproduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.