OPALIN (NM_001284322) Human Untagged Clone
CAT#: SC333789
OPALIN (untagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 6
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HTMP10; TMEM10; TMP10 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333789 representing NM_001284322.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGGATGACGTCCTCTCCTGTCACAGGTGGGAAAGAAACGGACTGTGGGCCCTCTCTTGGATTAGCG GCGGGCATACCATTGCTGGTGGCCACAGCCCTGCTGGTGGCTTTACTATTTACTTTGATTCACCGAAGA AGAAGCAGCATTGAGGCCATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCC AAGATATCTGAGAATCCTAGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCAC ATATATGTGAAGACTGTAGCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATG GAAAGAAGGAGGGGATTGTGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284322 |
Insert Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001284322.1 |
RefSeq Size | 3717 bp |
RefSeq ORF | 396 bp |
Locus ID | 93377 |
UniProt ID | Q96PE5 |
Protein Families | Transmembrane |
MW | 14.7 kDa |
Gene Summary | Central nervous system-specific myelin protein that increase myelin genes expression during oligodendrocyte differentiation. Promotes oligodendrocyte terminal differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) contains an alternate exon and uses an alternate start codon compared to variant 1. It encodes isoform c which is shorter and has a distinct N-terminus compared to isoform a. Variants 3, 6, 7 and 8 encode the same isoform (c). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235895 | OPALIN (myc-DDK-tagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 6 |
CNY 3990.00 |
|
RG235895 | OPALIN (tGFP-tagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 6 |
CNY 4370.00 |