Prol1 (OPRPN) (NM_001302807) Human Untagged Clone

CAT#: SC333750

PROL1 (untagged) - Human proline rich, lacrimal 1 (PROL1), transcript variant 2



  "NM_001302807" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
OPRPN Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BPLP; opiorphin; PRL1; PROL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333750 representing NM_001302807.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAATTAACTTTCTTCTTGGGCCTGTTGGCTCTTATTTCATGTTTCACATCAGCGGTTGCTAAGCAT
GAAGGGACAGTGGACTGCAGGAAGAGGACACAGGGCAGCCCAGTGAGAGTCAAAGATTCTCCAGAAGAC
CATATCTACCTGGCCAGCTGCCACCACCTCCACTCTACAGGCCAAGATGGGTTCCACCAAGTCCCCCAC
CTCCCTATGACTCAAGACTTAATTCACCACTTTCTCTTCCCTTTGTCCCAGGGCGAGTTCCACCATCTT
CTTTCTCTCGATTTAGCCAAGCAGTCATTCTATCTCAACTCTTTCCATTGGAATCTATTAGACAACCTC
GACTCTTTCCGGGTTATCCAAACCTACATTTCCCACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302807
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302807.1
RefSeq Size 1116 bp
RefSeq ORF 384 bp
Locus ID 58503
Protein Families Secreted Protein
MW 14.6 kDa
Gene Summary This gene encodes a member of the proline-rich protein family. The encoded protein has multiple proposed functions, including roles in pain suppression, penile erection, and protection of the eye surface. The QRFSR pentapeptide, known as opiorphin, is derived from the N-terminal of this protein. Opiorphin inhibits the enkephalin-inactivating peptidases neprilysin and aminopeptidase N, and this activity is thought to reduce sensitivity to painful stimuli by effecting enkephalin-related activation of opioid-dependent pathways. Opiorphin may also act as an anti-depressant. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (2) contains an alternate exon in the 5' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. This isoform (2) lacks the functional QRFSR pentapeptide, known as opiorphin, located in the N-terminal of isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...