SPINLW1 (EPPIN) (NM_001302861) Human Untagged Clone

CAT#: SC333745

EPPIN (untagged) - Human epididymal peptidase inhibitor (EPPIN), transcript variant 2



  "NM_001302861" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-EPPIN Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT71; CT72; dJ461P17.2; SPINLW1; WAP7; WFDC7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333745 representing NM_001302861.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGATCTTCTGGACTTTTGAGCCTCCTGGTGCTATTCGTCCTCTTAGCGAATGTCCAGGGACCTGGT
CTGACTGATTGGTTATTTCCCAGGAGATGTCCCAAAATCAGAGAAGAATGTGAATTCCAAGAAAGGGAT
GTGTGTACAAAGGACAGACAATGCCAGGACAACAAGAAGTGTTGTGTCTTCAGCTGCGGAAAAAAATGT
TTAGATCTCAAACAAGTCTCTCTGCAGATGTATGCGAAATGCCAAAAGAAACTGGCCCCTGCCTGGCTT
ATTTTCTTCATTGGTGGTATGACAAGAAAGATAATACTTGCTCCATGTTTGTCTATGGTGGCTGCCAGG
GAAACAATAACAACTTCCAATCCAAAGCCAACTGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302861
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302861.1
RefSeq Size 800 bp
RefSeq ORF 384 bp
Locus ID 57119
UniProt ID O95925
Protein Families Secreted Protein
MW 14.2 kDa
Gene Summary This gene encodes an epididymal protease inhibitor, which contains both kunitz-type and WAP-type four-disulfide core (WFDC) protease inhibitor consensus sequences. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene is a member of the WFDC gene family and belongs to the telomeric cluster. The protein can inhibit human sperm motility and exhibits antimicrobial activity against E. coli, and polymorphisms in this gene are associated with male infertility. Read-through transcription also exists between this gene and the downstream WFDC6 (WAP four-disulfide core domain 6) gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (3) uses an alternate splice junction in a 3' coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...