TMEM188 (CNEP1R1) (NM_001281789) Human Untagged Clone
CAT#: SC333727
CNEP1R1 (untagged) - Human CTD nuclear envelope phosphatase 1 regulatory subunit 1 (CNEP1R1), transcript variant 2
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C16orf69; NEP1-R1; NEP1R1; TMEM188; TMP125 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC333727 representing NM_001281789.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACTCGCTGGAGCAGGCGGAAGATCTCAAGGCTTTTGAGAGGAGACTTACTGAATATATTCATTGT TTGCAACCTGCTACTGGACGCTGGAGAATGCTTCTTATAGTGGTATCTGTCTGTACAGCTACTGGTGCC TGGAACTGGTTAATAGACCCTGAGACACAAAAGGTGTCCTTCTTCACATCATTATGGAATCACCCATTT TTCACCATTAGCTGTATCACTCTAATAGGCTTGTTCTTTGCTGGAATACACAAGAGAGTAGTTGCACCA TCAATTATAGCTGCTCGATGTCGAACGGTATTAGCAGAATACAATATGTCTTGTGATGATACAGGAAAA CTAATTTTGAAACCTAGGCCTCATGTTCAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001281789 |
| Insert Size | 378 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001281789.1 |
| RefSeq Size | 2150 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 255919 |
| UniProt ID | Q8N9A8 |
| MW | 14.3 kDa |
| Gene Summary | This gene encodes a transmembrane protein that belongs to the Tmemb_18A family. A similar protein in yeast is a component of an endoplasmic reticulum-associated protein phosphatase complex and is thought to play a role in the synthesis of triacylglycerol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2, also known as ERAdP) lacks an in-frame exon in the coding region compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC235833 | CNEP1R1 (myc-DDK-tagged) - Human CTD nuclear envelope phosphatase 1 regulatory subunit 1 (CNEP1R1), transcript variant 2 |
CNY 1320.00 |
|
| RG235833 | CNEP1R1 (tGFP-tagged) - Human CTD nuclear envelope phosphatase 1 regulatory subunit 1 (CNEP1R1), transcript variant 2 |
CNY 4370.00 |
其它TMEM188产品
