COLCA1 (NM_001302645) Human Untagged Clone

CAT#: SC333709

COLCA1 (untagged) - Human colorectal cancer associated 1 (COLCA1), transcript variant 2



  "NM_001302645" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C11orf92; CASC12; LOH11CR1F
Vector pCMV6-Entry
Sequence Data
>SC333709 representing NM_001302645.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTCTTGCTCAGTCGCCCAGGCTGGAGTGCTAACCTCTCCTTTCATGTGGAGATGGACAGGGATG
GCAGGAGCACTGAGTGCTCTTGACAACACCATTGAAGATGATGCTGACGATCAGCTACCCTGTGGAGAA
GGCAGGCCAGGCTGGGTGAGAGGGGAGCTCCTTGGAAGTCAGGGGGTCTGTAAGGACAGCAAGGATCTC
TTTGTCCCAACCTCCAGCAGCCTTTATGGGTGCTTCTGTGTTGGCCTTGTTTCTGGGATGGCCATCTCA
GTGCTGTTGCTGGCTAGCGATTTCAGAAAACTAGATTTTTCTAGGCCTGAGCCCTGTTTTGAGAAAGAA
GCTTCCCTCTGGTTTGTAGCTCAACATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001302645
Insert Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302645.1
RefSeq Size 5366 bp
RefSeq ORF 375 bp
Locus ID 399948
UniProt ID Q6ZS62
Protein Families Transmembrane
MW 13.4 kDa
Gene Summary This gene encodes a transmembrane protein that localizes to granular structures, including crystalloid eosinophilic granules and other granular organelles. This gene, along with an overlapping opposite strand gene, has been implicated as a susceptibility locus for colorectal cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and it thus differs in the 5' UTR, compared to variant 3. All variants (1 through 6) encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...