JPT1 (NM_001288610) Human Untagged Clone

CAT#: SC333557

HN1 (untagged) - Human hematological and neurological expressed 1 (HN1), transcript variant 6



  "NM_001288610" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal antibody to HN1 (hematological and neurological expressed 1)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARM2; HN1; HN1A
Vector pCMV6-Entry
Sequence Data
>SC333557 representing NM_001288610.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTCTAATATCTTTGGGACACCTGAAGAAAATCAAGCTTCTTGGGCCAAGTCAGCAGGTGCCAAG
TCTAGTGGTGGCAGGGAAGACTTGGAGTCATCTGGACTGCAGAGAAGGAACTCCTCTGAAGCAAGCTCC
GGAGACTTCTTAGATCTGAAGGGAGAAGGTGATATTCATGAAAATGTGGACACAGACTTGCCAGGCAGC
CTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCGGCCCCAGTG
CCATCCAGAAGAAATCCCCCTGGCGGCAAGTCCAGCCTCGTCTTGGGTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001288610
Insert Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288610.1
RefSeq Size 1657 bp
RefSeq ORF 327 bp
Locus ID 51155
UniProt ID Q9UK76
MW 11 kDa
Gene Summary Modulates negatively AKT-mediated GSK3B signaling (PubMed:21323578, PubMed:22155408). Induces CTNNB1 'Ser-33' phosphorylation and degradation through the suppression of the inhibitory 'Ser-9' phosphorylation of GSK3B, which represses the function of the APC:CTNNB1:GSK3B complex and the interaction with CDH1/E-cadherin in adherent junctions (PubMed:25169422). Plays a role in the regulation of cell cycle and cell adhesion (PubMed:25169422, PubMed:25450365). Has an inhibitory role on AR-signaling pathway through the induction of receptor proteosomal degradation (PubMed:22155408).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR and contains multiple coding region differences, one of which results in a frameshift and an early stop codon, compared to variant 2. Variants 3, 5 and 6 encode the same isoform (3), which is shorter and has distinct N- and C-termini, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...