Protamine 2 (PRM2) (NM_001286359) Human Untagged Clone

CAT#: SC333505

PRM2 (untagged) - Human protamine 2 (PRM2), transcript variant 5



  "NM_001286359" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT94.2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333505 representing NM_001286359.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCCGATACCGCGTGAGGAGCCTGAGCGAACGCTCGCACGAGGTGTACAGGCAGCAGTTGCATGGG
CAAGAGCAAGGACACCACGGCCAAGAGGAGCAAGGGCTGAGCCCGGAGCACGTCGAGGTCTACGAGAGG
ACCCATGGCCAGTCTCACTATAGGCGCAGACACTGCTCTCGAAGGAGGCTGCACCGGATCCACAGGCGG
CAGCATCGCTCCTGCAGAAGGCGCAAAAGACGCTCCTGCAGGCACCGGAGGAGGCATCGCAGAGGTCTG
CCTGCGCCCCCGCCTTGCCCTGCATGTCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286359
Insert Size 309 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286359.1
RefSeq Size 730 bp
RefSeq ORF 309 bp
Locus ID 5620
UniProt ID P04554
MW 12.6 kDa
Gene Summary Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis, and are the major DNA-binding proteins in the nucleus of sperm in many vertebrates. They package the sperm DNA into a highly condensed complex in a volume less than 5% of a somatic cell nucleus. Many mammalian species have only one protamine (protamine 1); however, a few species, including human and mouse, have two. This gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (5) uses an alternate donor splice site at the first exon compared to variant 1. The resulting isoform (5) has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...