DYNLT1 (NM_001291602) Human Untagged Clone

CAT#: SC333485

DYNLT1 (untagged) - Human dynein, light chain, Tctex-type 1 (DYNLT1), transcript variant 2



  "NM_001291602" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DYNLT1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CW-1; TCTEL1; tctex-1; TCTEX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333485 representing NM_001291602.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGACTACCAGGCTGCGGAGGAGGCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGC
AAAGTGAACCAGTGGACCACAAATGTAGTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCA
TTTAAATACATCGTGACCTGTGTAATTATGCAGAAGAATGGAGCTGGATTACACACAGCAAGTTCCTGC
TTCTGGGACAGCTCTACTGACGGGAGCTGCACTGTGCGATGGGAGAATAAGACCATGTACTGCATCGTC
AGTGCCTTCGGACTGTCTATTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291602
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291602.1
RefSeq Size 746 bp
RefSeq ORF 300 bp
Locus ID 6993
MW 10.9 kDa
Gene Summary This gene encodes a component of the motor complex, cytoplasmic dynein, which transports cellular cargo along microtubules in the cell. The encoded protein regulates the length of primary cilia which are sensory organelles found on the surface of cells. The protein encoded by this gene interacts with viral proteins, like the minor capsid protein L2 of human papillomavirus, and is required for dynein-mediated delivery of the viral nucleic acid to the host nucleus. This protein interacts with oncogenic nucleoporins to disrupt gene regulation and cause leukemic transformation. Pseudogenes of this gene are present on chromosomes 4 and 17. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...