LYRM7 (NM_001293735) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	C5orf31; MC3DN8; MZM1L
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333330 representing NM_001293735. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGACGGGCAGTCAAGGTTTTACAGCTCTTTAAAACACTGCACAGGACCAGACAACAAGTTTTTAAA AATGATGCCAGAGCATTAGAAGCAGCCAGAATAAAGATAAATGAAGAATTCAAAAATAATAAAAGTGAA ACTTCTTCTAAGAAAATAGAAGAGAACTGGTCCCTAGGAAAGACCTTCTTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001293735
Insert Size	192 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001293735.1
RefSeq Size	6165 bp
RefSeq ORF	192 bp
Locus ID	90624
MW	7.4 kDa
Gene Summary	Inner mitochondrial membrane complex III (CIII) is the main enzyme complex in the mitochondrial respiratory chain, and Rieske Fe-S protein (UQCRFS1) is the last catalytic subunit added to the complex. The protein encoded by this gene is a nuclear-encoded mitochondrial matrix protein that stabilizes UQCRFS1 and chaperones it to the CIII complex. Defects in this gene are a cause of mitochondrial complex III deficiency, nuclear type 8. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (2) lacks an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.