MAZ (NM_001276276) Human Untagged Clone
CAT#: SC333232
MAZ (untagged) - Homo sapiens MYC-associated zinc finger protein (purine-binding transcription factor) (MAZ), transcript variant 4
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Pur-1; PUR1; SAF-1; SAF-2; SAF-3; ZF87; Zif87; ZNF801 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333232 representing NM_001276276.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTCCCGGTGTTTCCTTGCACGCTGCTGGCCCCCCCCTTCCCCGTGCTGGGCCTGGACTCCCGGGGG GTGGGCGGCCTCATGAACTCCTTCCCGCCACCTCAGGGTCACGCCCAGAACCCCCTGCAGGTCGGGGCT GAGCTCCAGTCCCGCTTCTTTGCCTCCCAGGGCTGCGCCCAGAGTCCATTCCAGAAATGTGAGGCAGCT TTCGCCACGAAGGATCGGCTGCGGGCGCACACAGTACGACACGAGGAGAAAGTGCCATGTCACGTGTGT GGCAAGATGCTGAGCTCGGCTTATATTTCGGACCACATGAAGGTGCACAGCCAGGGTCCTCACCATGTC TGTGAGCTCTGCAACAAAGGTACTGGTGAGGTTTGTCCAATGGCGGCGGCAGCGGCAGCGGCGGCAGCG GCAGCAGCGGCAGCAGTAGCAGCCCCTCCCACAGCTGTGGGCTCCCTCTCGGGGGCGGAGGGGGTGCCT GTGAGCTCTCAGCCACTTCCCTCCCAACCCTGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276276 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001276276.1 |
RefSeq Size | 1644 bp |
RefSeq ORF | 519 bp |
Locus ID | 4150 |
UniProt ID | P56270 |
Protein Families | Transcription Factors |
MW | 17.8 kDa |
Gene Summary | May function as a transcription factor with dual roles in transcription initiation and termination. Binds to two sites, ME1a1 and ME1a2, within the MYC promoter having greater affinity for the former. Also binds to multiple G/C-rich sites within the promoter of the Sp1 family of transcription factors. Regulates inflammation-induced expression of serum amyloid A proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks three exons in the coding region, one of which results in a frameshift, compared to variant 2. It encodes isoform 4 which has a distinct C-terminus and is shorter than isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233358 | MAZ (Myc-DDK tagged) - Homo sapiens MYC-associated zinc finger protein (purine-binding transcription factor) (MAZ), transcript variant 4 |
CNY 2640.00 |
|
RG233358 | MAZ (tGFP-tagged) - Homo sapiens MYC-associated zinc finger protein (purine-binding transcription factor) (MAZ), transcript variant 4 |
CNY 4370.00 |