MAZ (NM_001276276) Human Untagged Clone

CAT#: SC333232

MAZ (untagged) - Homo sapiens MYC-associated zinc finger protein (purine-binding transcription factor) (MAZ), transcript variant 4



  "NM_001276276" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MAZ Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Pur-1; PUR1; SAF-1; SAF-2; SAF-3; ZF87; Zif87; ZNF801
Vector pCMV6-Entry
Sequence Data
>SC333232 representing NM_001276276.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCCCGGTGTTTCCTTGCACGCTGCTGGCCCCCCCCTTCCCCGTGCTGGGCCTGGACTCCCGGGGG
GTGGGCGGCCTCATGAACTCCTTCCCGCCACCTCAGGGTCACGCCCAGAACCCCCTGCAGGTCGGGGCT
GAGCTCCAGTCCCGCTTCTTTGCCTCCCAGGGCTGCGCCCAGAGTCCATTCCAGAAATGTGAGGCAGCT
TTCGCCACGAAGGATCGGCTGCGGGCGCACACAGTACGACACGAGGAGAAAGTGCCATGTCACGTGTGT
GGCAAGATGCTGAGCTCGGCTTATATTTCGGACCACATGAAGGTGCACAGCCAGGGTCCTCACCATGTC
TGTGAGCTCTGCAACAAAGGTACTGGTGAGGTTTGTCCAATGGCGGCGGCAGCGGCAGCGGCGGCAGCG
GCAGCAGCGGCAGCAGTAGCAGCCCCTCCCACAGCTGTGGGCTCCCTCTCGGGGGCGGAGGGGGTGCCT
GTGAGCTCTCAGCCACTTCCCTCCCAACCCTGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001276276
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276276.1
RefSeq Size 1644 bp
RefSeq ORF 519 bp
Locus ID 4150
UniProt ID P56270
Protein Families Transcription Factors
MW 17.8 kDa
Gene Summary May function as a transcription factor with dual roles in transcription initiation and termination. Binds to two sites, ME1a1 and ME1a2, within the MYC promoter having greater affinity for the former. Also binds to multiple G/C-rich sites within the promoter of the Sp1 family of transcription factors. Regulates inflammation-induced expression of serum amyloid A proteins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks three exons in the coding region, one of which results in a frameshift, compared to variant 2. It encodes isoform 4 which has a distinct C-terminus and is shorter than isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...