MMP19 (NM_001272101) Human Untagged Clone

CAT#: SC333211

MMP19 (untagged) - Homo sapiens matrix metallopeptidase 19 (MMP19), transcript variant 3



  "NM_001272101" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MMP19 Antibody
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CODA; MMP18; RASI-1
Vector pCMV6-Entry
Sequence Data
>SC333211 representing NM_001272101.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACTGCCAGCAGCTGTGGCTGGGCTTCCTACTCCCCATGACAGTCTCAGGCCGGGTCCTGGGGCTT
GCAGAGGTGGCGCCCGTGGACTACCTGTCACAATATGGGTACCTACAGAAGCCTCTAGAAGGATCTAAT
AACTTCAAGCCAGAAGATATCACCGAGGCTCTGAGAGCTTTTCAGGAAGCATCTGAACTTCCAGTCTCA
GGTCAGCTGGATGATGCCACAAGGGCCCGCATGAGGCAGCCTCGTTGTGGCCTAGAGGATCCCTTCAAC
CAGAAGACCCTTAAATACCTGTTGCTGGGCCGCTGGAGAAAGAAGCACCTGACTTTCCGCATCTTGAAC
CTGCCCTCCACCCTTCCACCCCACACAGCCCGGGCAGCCCTGCGTCAAGCCTTCCAGGACTGGAGCAAT
GTGGCTCCCTTGACCTTCCAAGAGGTGCAGGCTGGTGCGGCTGACATCCGCCTCTCCTTCCATGGCCGC
CAAAGCTCGTACTGTTCCAATACTTTTGATGGGCCTGGCAAGAAGAGTCCAGTGATAAGGGATGAGGAA
GAAGAAGAGACAGAGCTGCCCACTGTGCCCCCAGTGCCCACAGAACCCAGTCCCATGCCAGACCCTTGC
AGTAGTGAACTGGATGCCATGATGCTGGGTGAGGCCCCTCCCCTCCAGGCTGTTGGCAGGCGGTGGGGG
CAGCCTGCTGATCCTGAGGCCTGGACAAATGGGAGTGACATGGGACTTCAGCATGAGCAATGGAGGGCC
CCGTGGGAAGACCTATGCTTTCAAGGGGGACTATGTGTGGACTGTATCAGATTCAGGACCGGGCCCCTT
GTTCCGAGTGTCTGCCCTTTGGGAGGGGCTCCCCGGAAACCTGGATGCTGCTGTCTACTCGCCTCGAAC
ACAATGGATTCACTTCTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001272101
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272101.1
RefSeq Size 3026 bp
RefSeq ORF 918 bp
Locus ID 4327
UniProt ID Q99542
Protein Families Protease, Secreted Protein
MW 33.8 kDa
Gene Summary This gene encodes a member of a family of proteins that are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded protein is secreted as an inactive proprotein, which is activated upon cleavage by extracellular proteases. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) contains multiple differences in the coding region, compared to variant 1, one of which results in a frameshift. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...