SHISA5 (NM_001272083) Human Untagged Clone

CAT#: SC333206

SHISA5 (untagged) - Homo sapiens shisa family member 5 (SHISA5), transcript variant 7



  "NM_001272083" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SCOTIN Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SCOTIN
Vector pCMV6-Entry
Sequence Data
>SC333206 representing NM_001272083.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGTTCGGAGCGACCTTGGCCGTTGGCCTGACCATCTTTGTGCTGTCTGTCGTCACTATCATCATC
TGCTTCACCTGCTCCTGCTGCTGCCTTTACAAGACGTGCCGCCGACCACGTCCGGTTGTCACCACCACC
ACATCCACCACTGTGGTGCATGCCCCTTATCCTCAGCCTCCAAGTGTGCCGCCCAGCTACCCTGGACCA
AGCTACCAGGGCTACCACACCATGCCGCCTCAGCCAGGGATGCCAGCAGCACCCTACCCAATGCAGTAC
CCACCACCTTACCCAGCCCAGCCCATGGGCCCACCGGCCTACCACGAGACCCTGGCTGGTGAGTGCCCC
TGCCAACTCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001272083
Insert Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272083.1
RefSeq Size 2216 bp
RefSeq ORF 357 bp
Locus ID 51246
UniProt ID Q8N114
Protein Families Transmembrane
Protein Pathways p53 signaling pathway
MW 12.7 kDa
Gene Summary This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
Transcript Variant: This variant (7) contains an alternate 5' terminal exon, initiates translation at an alternate start codon, and differs at the 3' end compared to variant 1. The encoded isoform (e) has distinct N- and C- termini and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...