TFEB (NM_001271943) Human Untagged Clone

CAT#: SC333159

TFEB (untagged) - Homo sapiens transcription factor EB (TFEB), transcript variant 5



  "NM_001271943" in other vectors (2)

CNY 3710.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TFEB Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALPHATFEB; BHLHE35; TCFEB
Vector pCMV6-Entry
Sequence Data
>SC333159 representing NM_001271943.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGTCACGCATAGGGTTGCGCATGCAGCTCATGCGGGAGCAGGCGCAGCAGGAGGAGCAGCGGGAG
CGCATGCAGCAACAGGCTGTCATGCATTACATGCAGCAGCAGCAGCAGCAGCAACAGCAGCAGCTCGGA
GGGCCGCCCACCCCGGCCATCAATACCCCCGTCCACTTCCAGTCGCCACCACCTGTGCCTGGGGAGGTG
TTGAAGTTGGATGATGTCATTGACAACATTATGCGTCTGGACGATGTCCTTGGCTACATCAATCCTGAA
ATGCAGATGCCCAACACGCTACCCCTGTCCAGCAGCCACCTGAATGTGTACAGCAGCGACCCCCAGGTC
ACAGCCTCCCTGGTGGGCGTCACCAGCAGCTCCTGCCCTGCGGACCTGACCCAGAAGCGAGAGCTCACA
GATGCTGAGAGCAGGGCCCTGGCCAAGGAGCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGA
CGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGAC
GTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTG
CAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGT
ATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATG
GCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATG
CTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCC
ACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCACAGCCTGAGCTTTGGGGGCAGGGAGGAC
GAGGGTCCCCCGGGCTACCCCGAACCCCTGGCGCCGGGGCATGGCTCCCCATTCCCCAGCCTGTCCAAG
AAGGATCTGGACCTCATGCTCCTGGACGACTCACTGCTACCGCTGGCCTCTGATCCACTTCTGTCCACC
ATGTCCCCCGAGGCCTCCAAGGCCAGCAGCCGCCGGAGCAGCTTCAGCATGGAGGAGGGCGATGTGCTG
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001271943
Insert Size 1176 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271943.1
RefSeq Size 2089 bp
RefSeq ORF 1176 bp
Locus ID 7942
UniProt ID P19484
Protein Families Druggable Genome, Transcription Factors
MW 43.8 kDa
Gene Summary Transcription factor that specifically recognizes and binds E-box sequences (5'-CANNTG-3'). Efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFE3 or MITF. In association with TFE3, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression. It thereby plays a central role in expression of lysosomal genes. Acts as a positive regulator of autophagy by promoting expression of genes involved in autophagy. Specifically recognizes the gamma-E3 box, a subset of E-boxes, present in the heavy-chain immunoglobulin enhancer. Plays a role in the signal transduction processes required for normal vascularization of the placenta. Regulates lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1 (PubMed:29146937).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) contains an alternate 5' exon, which results in a downstream AUG start codon, and also lacks an in-frame coding exon, compared to variant 2. The resulting isoform (3) has a shorter N-terminus and lacks an internal segment, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...