OTX2 (NM_001270525) Human Untagged Clone

CAT#: SC332968

OTX2 (untagged) - Homo sapiens orthodenticle homeobox 2 (OTX2), transcript variant 5



  "NM_001270525" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
OTX2 mouse monoclonal antibody,clone OTI1A1
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPHD6; MCOPS5
Vector pCMV6-Entry
Sequence Data
>SC332968 representing NM_001270525.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGTCTTATCTTAAGCAACCGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGAC
TTGCTGCACCCCTCCGTGGGCTACCCGGGGCCCTGGGCTTCTTGTCCCGCAGCCACCCCCCGGAAACAG
CGCCGGGAGAGGACGACGTTCACTCGGGCGCAGCTAGATGTGCTGGAAGCACTGTTTGCCAAGACCCGG
TACCCAGACATCTTCATGCGAGAGGAGGTGGCACTGAAAATCAACTTGCCCGAGTCGAGGGTGCAGGTA
TGGTTTAAGAATCGAAGAGCTAAGTGCCGCCAACAACAGCAACAACAGCAGAATGGAGGTCAAAACAAA
GTGAGACCTGCCAAAAAGAAGACATCTCCAGCTCGGGAAGTGAGTTCAGAGAGTGGAACAAGTGGCCAA
TTCACTCCCCCCTCTAGCACCTCAGTCCCGACCATTGCCAGCAGCAGTGCTCCTGTGTCTATCTGGAGC
CCAGCTTCCATCTCCCCACTGTCAGATCCCTTGTCCACCTCCTCTTCCTGCATGCAGAGGTCCTATCCC
ATGACCTATACTCAGGCTTCAGGTTATAGTCAAGGATATGCTGGCTCAACTTCCTACTTTGGGGGCATG
GACTGTGGATCATATTTGACCCCTATGCATCACCAGCTTCCCGGACCAGGGGCCACACTCAGTCCCATG
GGTACCAATGCAGTCACCAGCCATCTCAATCAGTCCCCAGCTTCTCTTTCCACCCAGGGATATGGAGCT
TCAAGCTTGGGTTTTAACTCAACCACTGATTGCTTGGATTATAAGGACCAAACTGCCTCCTGGAAGCTT
AACTTCAATGCTGACTGCTTGGATTATAAAGATCAGACATCCTCGTGGAAATTCCAGGTTTTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270525
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270525.1
RefSeq Size 2142 bp
RefSeq ORF 894 bp
Locus ID 5015
UniProt ID P32243
Protein Families Embryonic stem cells, Induced pluripotent stem cells, Stem cell - Pluripotency, Transcription Factors
MW 32.4 kDa
Gene Summary This gene encodes a member of the bicoid subfamily of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and plays a role in brain, craniofacial, and sensory organ development. The encoded protein also influences the proliferation and differentiation of dopaminergic neuronal progenitor cells during mitosis. Mutations in this gene cause syndromic microphthalmia 5 (MCOPS5) and combined pituitary hormone deficiency 6 (CPHD6). This gene is also suspected of having an oncogenic role in medulloblastoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Pseudogenes of this gene are known to exist on chromosomes two and nine. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1, and encodes the longer isoform (a). Variants 1 and 5 encode the same protein (isoform a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...