IL3RA (NM_001267713) Human Untagged Clone
CAT#: SC332872
IL3RA (untagged) - Homo sapiens interleukin 3 receptor, alpha (low affinity) (IL3RA), transcript variant 2
CNY 2950.00
Product images

CNY 1999.00
CNY 3600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD123; hIL-3Ra; IL3R; IL3RAY; IL3RX; IL3RY |
Vector | pCMV6-Entry |
Sequence Data |
>SC332872 representing NM_001267713.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTCCTCCTTTGGCTCACGCTGCTCCTGATCGCCCTGCCCTGTCTCCTGCAAACGAAGGAAGGTGGG AAGCCTTGGGCAGGTGCGGAGAATCTGACCTGCTGGATTCATGACGTGGATTTCTTGAGCTGCAGCTGG GCGGTAGGCCCGGGGGCCCCCGCGGACGTCCAGTACGACCTGTACTTGAACGTTGCCAACAGGCGTCAA CAGTACGAGTGTCTTCACTACAAAACGGATGCTCAGGGAACACGTATCGGGTGTCGTTTCGATGACATC TCTCGACTCTCCAGCGGTTCTCAAAGTTCCCACATCCTGGTGCGGGGCAGGAGCGCAGCCTTCGGTATC CCCTGCACAGATAAGTTTGTCGTCTTTTCACAGATTGAGATATTAACTCCACCCAACATGACTGCAAAG TGTAATAAGACACATTCCTTTATGCACTGGAAAATGAGAAGTCATTTCAATCGCAAATTTCGCTATGAG CTTCAGATACAAAAGAGAATGCAGCCTGTAATCACAGAACAGGTCAGAGACAGAACCTCCTTCCAGCTA CTCAATCCTGGAACGTACACAGTACAAATAAGAGCCCGGGAAAGAGTGTATGAATTCTTGAGCGCCTGG AGCACCCCCCAGCGCTTCGAGTGCGACCAGGAGGAGGGCGCAAACACACGTGCCTGGCGGACGTCGCTG CTGATCGCGCTGGGGACGCTGCTGGCCCTGGTCTGTGTCTTCGTGATCTGCAGAAGGTATCTGGTGATG CAGAGACTCTTTCCCCGCATCCCTCACATGAAAGACCCCATCGGTGACAGCTTCCAAAACGACAAGCTG GTGGTCTGGGAGGCGGGCAAAGCCGGCCTGGAGGAGTGTCTGGTGACTGAAGTACAGGTCGTGCAGAAA ACTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267713 |
Insert Size | 903 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001267713.1 |
RefSeq Size | 1479 bp |
RefSeq ORF | 903 bp |
Locus ID | 3563 |
UniProt ID | P26951 |
Protein Families | Transmembrane |
Protein Pathways | Apoptosis, Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
MW | 34.5 kDa |
Gene Summary | The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (2) lacks two in-frame exons in the 5' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment in the N-terminal region, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233695 | IL3RA (Myc-DDK tagged) - Homo sapiens interleukin 3 receptor, alpha (low affinity) (IL3RA), transcript variant 2 |
CNY 2640.00 |
|
RG233695 | IL3RA (tGFP-tagged) - Homo sapiens interleukin 3 receptor, alpha (low affinity) (IL3RA), transcript variant 2 |
CNY 4240.00 |