IL3RA (NM_001267713) Human Untagged Clone

CAT#: SC332872

IL3RA (untagged) - Homo sapiens interleukin 3 receptor, alpha (low affinity) (IL3RA), transcript variant 2



  "NM_001267713" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IL3RA mouse monoclonal antibody, clone OTI10D4
    • 100 ul

CNY 1999.00
CNY 3600.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD123; hIL-3Ra; IL3R; IL3RAY; IL3RX; IL3RY
Vector pCMV6-Entry
Sequence Data
>SC332872 representing NM_001267713.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCCTCCTTTGGCTCACGCTGCTCCTGATCGCCCTGCCCTGTCTCCTGCAAACGAAGGAAGGTGGG
AAGCCTTGGGCAGGTGCGGAGAATCTGACCTGCTGGATTCATGACGTGGATTTCTTGAGCTGCAGCTGG
GCGGTAGGCCCGGGGGCCCCCGCGGACGTCCAGTACGACCTGTACTTGAACGTTGCCAACAGGCGTCAA
CAGTACGAGTGTCTTCACTACAAAACGGATGCTCAGGGAACACGTATCGGGTGTCGTTTCGATGACATC
TCTCGACTCTCCAGCGGTTCTCAAAGTTCCCACATCCTGGTGCGGGGCAGGAGCGCAGCCTTCGGTATC
CCCTGCACAGATAAGTTTGTCGTCTTTTCACAGATTGAGATATTAACTCCACCCAACATGACTGCAAAG
TGTAATAAGACACATTCCTTTATGCACTGGAAAATGAGAAGTCATTTCAATCGCAAATTTCGCTATGAG
CTTCAGATACAAAAGAGAATGCAGCCTGTAATCACAGAACAGGTCAGAGACAGAACCTCCTTCCAGCTA
CTCAATCCTGGAACGTACACAGTACAAATAAGAGCCCGGGAAAGAGTGTATGAATTCTTGAGCGCCTGG
AGCACCCCCCAGCGCTTCGAGTGCGACCAGGAGGAGGGCGCAAACACACGTGCCTGGCGGACGTCGCTG
CTGATCGCGCTGGGGACGCTGCTGGCCCTGGTCTGTGTCTTCGTGATCTGCAGAAGGTATCTGGTGATG
CAGAGACTCTTTCCCCGCATCCCTCACATGAAAGACCCCATCGGTGACAGCTTCCAAAACGACAAGCTG
GTGGTCTGGGAGGCGGGCAAAGCCGGCCTGGAGGAGTGTCTGGTGACTGAAGTACAGGTCGTGCAGAAA
ACTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267713
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267713.1
RefSeq Size 1479 bp
RefSeq ORF 903 bp
Locus ID 3563
UniProt ID P26951
Protein Families Transmembrane
Protein Pathways Apoptosis, Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
MW 34.5 kDa
Gene Summary The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (2) lacks two in-frame exons in the 5' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment in the N-terminal region, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...