FKSG14 (CENPK) (NM_001267038) Human Untagged Clone

CAT#: SC332833

CENPK (untagged) - Homo sapiens centromere protein K (CENPK), transcript variant 2



  "NM_001267038" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CENPK Antibody - N-terminal region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AF5alpha; CENP-K; FKSG14; P33; Solt
Vector pCMV6-Entry
Sequence Data
>SC332833 representing NM_001267038.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATCAGGAGGATCTAGATCCGGATAGTACTACAGATGTGGGAGATGTTACAAATACTGAAGAAGAA
CTTATTAGAGAATGTGAAGAAATGTGGAAAGATATGGAAGAATGTCAGAATAAATTATCACTTATTGGA
ACTGAAACACTCACCGATTCAAATGCTCAGCTATCATTGTTAATTATGCAAGTAAAATGTTTAACCGCT
GAACTCAGTCAATGGCAGAAAAAAACACCTGAAACAATTCCCTTGACTGAAGACGTTCTCATAACATTA
GGAAAAGAAGAGTTCCAAAAGCTGAGACAAGATCTTGAAATGGTACTGTCCACTAAGGAGTCAAAGAAT
GAAAAGTTAAAGGAAGACTTAGAAAGGGAACAACGGTGGTTGGATGAACAGCAACAGATAATGGAATCT
CTTAATGTACTACACAGTGAATTGAAAAATAAGGTTGAAACATTTTCTGAATCAAGAATCTTTAATGAA
CTGAAAACTAAAATGCTTAATATAAAAGAATATAAGGAGAAACTCTTGAGTACCTTGGGCGAGTTTCTA
GAAGACCATTTTCCTCTGCCTGATAGAAGTGTTAAAAAGAAAAAGAAAAACATTCAAGAATCATCTGTA
AACCTGATAACACTGCATGAAATGTTAGAGATTCTTATAAATAGATTATTTGATGTTCCACATGATCCA
TATGTCAAAATTAGTGATTCCTTTTGGCCACCTTATGTTGAGCTGCTGCTGCGTAATGGAATTGCCTTG
AGACATCCAGAAGATCCAACCCGAATAAGATTAGAAGCTTTCCATCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001267038
Insert Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267038.1
RefSeq Size 1719 bp
RefSeq ORF 810 bp
Locus ID 64105
UniProt ID Q9BS16
Protein Families Druggable Genome
MW 31.7 kDa
Gene Summary CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...