GPR1 (NM_001261455) Human Untagged Clone

CAT#: SC332782

GPR1 (untagged) - Homo sapiens G protein-coupled receptor 1 (GPR1), transcript variant 6



  "NM_001261455" in other vectors (2)

CNY 3420.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GPR1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC332782 representing NM_001261455.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGATTTGGAGGAAACATTATTTGAAGAATTTGAAAACTATTCCTATGACCTAGACTATTACTCT
CTGGAGTCTGATTTGGAGGAGAAAGTCCAGCTGGGAGTTGTTCACTGGGTCTCCCTGGTGTTATATTGT
TTGGCTTTTGTTCTGGGAATTCCAGGAAATGCCATCGTCATTTGGTTCACGGGGTTCAAGTGGAAGAAG
ACAGTCACCACTCTGTGGTTCCTCAATCTAGCCATTGCGGATTTCATTTTTCTTCTCTTTCTGCCCCTG
TACATCTCCTATGTGGCCATGAATTTCCACTGGCCCTTTGGCATCTGGCTGTGCAAAGCCAATTCCTTC
ACTGCCCAGTTGAACATGTTTGCCAGTGTTTTTTTCCTGACAGTGATCAGCCTGGACCACTATATCCAC
TTGATCCATCCTGTCTTATCTCATCGGCATCGAACCCTCAAGAACTCTCTGATTGTCATTATATTCATC
TGGCTTTTGGCTTCTCTAATTGGCGGTCCTGCCCTGTACTTCCGGGACACTGTGGAGTTCAATAATCAT
ACTCTTTGCTATAACAATTTTCAGAAGCATGATCCTGACCTCACTTTGATCAGGCACCATGTTCTGACT
TGGGTGAAATTTATCATTGGCTATCTCTTCCCTTTGCTAACAATGAGTATTTGCTACTTGTGTCTCATC
TTCAAGGTGAAGAAGCGAAGCATCCTGATCTCCAGTAGGCATTTCTGGACAATTCTGGTTGTGGTTGTG
GCCTTTGTGGTTTGCTGGACTCCTTATCACCTGTTTAGCATTTGGGAGCTCACCATTCACCACAATAGC
TATTCCCACCATGTGATGCAGGCTGGAATCCCCCTCTCCACTGGTTTGGCATTCCTCAATAGTTGCTTG
AACCCCATCCTTTATGTCCTAATTAGTAAGAAGTTCCAAGCTCGCTTCCGGTCCTCAGTTGCTGAGATA
CTCAAGTACACACTGTGGGAAGTCAGCTGTTCTGGCACAGTGAGTGAACAGCTCAGGAACTCAGAAACC
AAGAATCTGTGTCTCCTGGAAACAGCTCAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001261455
Insert Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261455.1
RefSeq Size 2168 bp
RefSeq ORF 1068 bp
Locus ID 2825
UniProt ID P46091
Protein Families Druggable Genome, GPCR, Transmembrane
MW 41.4 kDa
Gene Summary Receptor for the inflammation-associated leukocyte chemoattractant chemerin/RARRES2 suggesting a role for this receptor in the regulation of inflammation (PubMed:18165312). Receptor for TAFA1, mediates its effects on neuronal stem-cell proliferation and differentiation via the activation of ROCK/ERK and ROCK/STAT3 signaling pathway (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...