PPP1R1C (NM_001261424) Human Untagged Clone

CAT#: SC332773

PPP1R1C (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), transcript variant 1



  "NM_001261424" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-PPP1R1C antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IPP5
Vector pCMV6-Entry
Sequence Data
>SC332773 representing NM_001261424.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAA
GCAGCAGAGCAGCTGGGCTTTTGTCGTTCACAGATCAGGAAAAGAAGACCTACACCAGCATCACTTGTG
ATTCTCAATGAGCATAACCCCCCAGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAG
AATGCATCCCCTAAGCAAAGGAAGCAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTG
AAAGGCCAGAATGAATCAGCATTCCCTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAGCAGCGGGAC
CATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001261424
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261424.1
RefSeq Size 3053 bp
RefSeq ORF 351 bp
Locus ID 151242
UniProt ID Q8WVI7
Protein Families Druggable Genome, Phosphatase
MW 13.1 kDa
Gene Summary Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]).[supplied by OMIM, Feb 2010]
Transcript Variant: This variant (1) encodes the longest protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...