BLNK (NM_001258440) Human Untagged Clone

CAT#: SC332710

BLNK (untagged) - Homo sapiens B-cell linker (BLNK), transcript variant 3



  "NM_001258440" in other vectors (2)

CNY 3800.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
BLNK mouse monoclonal antibody, clone OTI4C9 (formerly 4C9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGM4; BASH; bca; BLNK-S; LY57; SLP-65; SLP65
Vector pCMV6-Entry
Sequence Data
>SC332710 representing NM_001258440.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACAAGCTTAATAAAATAACCGTCCCCGCCAGTCAGAAGTTGAGGCAGCTTCAAAAGATGGTCCAT
GATATTAAAAACAATGAAGGTGGAATAATGAATAAAATCAAAAAGCTAAAAGTCAAAGCACCTCCAAGT
GTTCCTCGAAGGGACTACGCTTCAGAGAGCCCTGCTGACGAAGAGGAGCAGTGGTCCGATGACTTTGAC
AGCGACTATGAAAATCCAGATGAGCACTCGGACTCAGAGATGTACGTGATGCCCGCCGAGGAGAACGCT
GATGACAGCTACGAGCCGCCTCCAGTAGAGCAGGAAACCAGGCCGGTTCACCCAGCCCTGCCCTTCGCC
AGAGGCGAGTATATAGACAATCGATCAAGCCAGAGGCATTCCCCACCCTTCAGCAAGACACTTCCCAGT
AAGCCCAGCTGGCCTTCAGAGAAAGCAAGGCTCACCTCCACCCTGCCGGCCCTGACTGCTTTGCAGAAA
CCTCAAGTCCCACCCAAACCCAAAGGCCTCCTTGAGGATGAGGCTGATTATGTGGTCCCCGTGGAAGAT
AATGATGAAAACTATATTCATCCCACAGAAAGCAGTTCACCTCCACCTGAAAAAGCTCCCATGGTGAAT
AGATCAACCAAGCCAAATTCCTCAACGCCCGCCTCTCCTCCAGGAACAGCTTCAGGTCGAAACAGTGGG
GCCTGGGAAACCAAGTCACCTCCACCAGCTGCACCATCCCCGTTGCCACGGGCCGGGAAAAAACCAACG
ACACCACTGAAGACAACTCCAGTTGCCTCTCAACAGAATGCTTCAAGTGTTTGTGAAGAAAAACCTATA
CCTGCTGAACGCCACCGAGGGTCAAGTCACAGACAAGAAGCTGTGCAGTCACCAGTGTTTCCTCCTGCC
CAGAAACAAATCCACCAAAAACCCATACCTCTGCCAAGATTTACAGAAGGGGGAAACCCAACTGTGGAT
GGGCCCCTACCCAGCTTTTCATCTAATTCCACTATTTCAGAACAGGAAGCTGGCGTTCTCTGCAAGCCA
TGGTATGCTGGAGCCTGTGATCGAAAGTCTGCTGAAGAGGCATTGCACAGATCAAACAAGTACTTTGGA
AGTGTTGCTGAAATCATCAGGAATCATCAACATAGTCCTTTGGTTCTTATTGACAGTCAGAATAACACA
AAAGATTCCACCAGACTGAAGTATGCAGTTAAAGTTTCATAA

Restriction Sites SgfI-MluI     
ACCN NM_001258440
Insert Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258440.1
RefSeq Size 1613 bp
RefSeq ORF 1215 bp
Locus ID 29760
UniProt ID Q8WV28
Protein Families Druggable Genome
Protein Pathways B cell receptor signaling pathway, Primary immunodeficiency
MW 44.5 kDa
Gene Summary This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) lacks an in-frame exon in the 3' coding region compared to variant 1, resulting in a shorter isoform (3) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...