Chk2 (CHEK2) (NM_001257387) Human Untagged Clone

CAT#: SC332541

CHEK2 (untagged) - Homo sapiens checkpoint kinase 2 (CHEK2), transcript variant 4



  "NM_001257387" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CHEK2 (CHK2) mouse monoclonal antibody, clone OTI5C4 (formerly 5C4)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDS1; CHK2; hCds1; HuCds1; LFS2; PP1425; RAD53
Vector pCMV6-Entry
Sequence Data
>SC332541 representing NM_001257387.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCTTTCGAGAGGAAAACATGTAAG
AAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCTATTGGTTCAGCAAGAGAGGCAGACCCAGCT
CTCAATGTTGAAACAGAAATAGAAATTTTGAAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAAC
TTTTTTGATGCAGAAGATTATTATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTG
GTGGGGAATAAACGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAG
TACCTTCATGAAAACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCTCAAGAA
GAGGACTGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAGACCTCTCTCATGAGA
ACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTTTCTGTTGGGACTGCTGGGTATAAC
CGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTTATCTGCCTTAGTGGGTATCCACCTTTCTCT
GAGCATAGGACTCAAGTGTCACTGAAGGATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTC
TGGGCAGAAGTCTCAGAGAAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGT
TTTACGACAGAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGAT
CTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACTAGTCGAAAG
CGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCTGTGTGTGCTGCTGTGTTG
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001257387
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257387.1
RefSeq Size 1976 bp
RefSeq ORF 969 bp
Locus ID 11200
UniProt ID O96017
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Cell cycle, p53 signaling pathway
MW 36.2 kDa
Gene Summary In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (4) contains an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (d) is shorter at the N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...