ELK1 (NM_001257168) Human Untagged Clone
CAT#: SC332511
ELK1 (untagged) - Homo sapiens ELK1, member of ETS oncogene family (ELK1), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
Sequence Data |
>SC332511 representing NM_001257168.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAATGGCCACATC ATCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAGGAGGTGGCCCGGCTGTGG GGGCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTCAGCCGGGCCTTGCGGTACTACTATGAC AAGAACATCATCCGCAAGGTGAGCGGCCAGAAGTTCGTCTACAAGTTTGTGTCCTACCCTGAGTCCCAT TGCGCCCCGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257168 |
Insert Size | 288 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001257168.1 |
RefSeq Size | 2056 bp |
RefSeq ORF | 288 bp |
Locus ID | 2002 |
UniProt ID | P19419 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Endometrial cancer, ErbB signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Prion diseases |
MW | 11.2 kDa |
Gene Summary | This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (3) uses two alternate splice sites and lacks an alternate exon which results in a frameshift in the central and 3' coding regions, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...