PCYT2 (NM_001256435) Human Untagged Clone

CAT#: SC332384

PCYT2 (untagged) - Homo sapiens phosphate cytidylyltransferase 2, ethanolamine (PCYT2), transcript variant 4



  "NM_001256435" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PCYT2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ET; SPG82
Vector pCMV6-Entry
Sequence Data
>SC332384 representing NM_001256435.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCAGGCCATCAAATGGGTGGACGAGGTGGTGCCAGCGGCTCCCTACGTCACTACACTAGAGACC
CTGGACAAATACAACTGTGACTTCTGTGTTCACGGCAATGACATCACCCTGACTGTAGATGGCCGGGAC
ACCTATGAGGAAGTAAAGCAGGCTGGGAGGTACAGAGAATGCAAGCGCACGCAAGGGGTGTCCACCACA
GACCTCGTGGGCCGCATGCTGCTGGTAACCAAAGCCCATCACAGCAGCCAGGAGATGTCCTCTGAGTAC
CGGGAGTATGCAGACAGTTTTGGCAAGTGCCCTGGTGGGCGGAACCCCTGGACCGGGGTATCCCAGTTC
CTGCAGACATCTCAGAAGATCATCCAGTTTGCTTCTGGGAAGGAGCCCCAGCCAGGGGAGACAGTCATC
TATGTGGCTGGTGCCTTCGACCTGTTCCACATCGGGCATGTGGACTTCCTGGAGAAGGTGCACAGGCTG
GCAGAGAGGCCCTACATCATCGCGGGCTTACACTTTGACCAGGAGGTCAATCACTACAAGGGGAAGAAC
TACCCCATCATGAATCTGCATGAACGGACTCTGAGCGTGCTGGCCTGCCGGTACGTGTCAGAAGTGGTG
ATTGGAGCCCCGTACGCGGTCACAGCAGAGCTCCTAAGTCACTTCAAGGTGGACCTGGTGTGTCACGGC
AAGACAGAAATTATCCCTGACAGGGATGGCTCCGACCCATACCAGGAGCCCAAGAGAAGGGGCATCTTC
CGTCAGATTGACAGTGGCAGCAACCTCACCACAGACCTCATCGTCCAGCGGATCATCACCAACAGGTTG
GAGTATGAGGCGCGAAACCAGAAGAAGGAAGCCAAGGAGCTGGCCTTCCTGGAGGCTGCCAGGCAGCAG
GCGGCACAGCCCCTGGGGGAGCGCGATGGTGACTTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256435
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256435.2
RefSeq Size 3525 bp
RefSeq ORF 936 bp
Locus ID 5833
UniProt ID Q99447
Protein Pathways Glycerophospholipid metabolism, Metabolic pathways
MW 35.2 kDa
Gene Summary This gene encodes an enzyme that catalyzes the formation of CDP-ethanolamine from CTP and phosphoethanolamine in the Kennedy pathway of phospholipid synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (4) uses an alternate splice site in its 5' UTR, uses a downstream in-frame start codon, and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1. Both variants 4 and 5 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...