Glycoprotein VI (GP6) (NM_001256017) Human Untagged Clone

CAT#: SC332283

GP6 (untagged) - Homo sapiens glycoprotein VI (platelet) (GP6), transcript variant 3



  "NM_001256017" in other vectors (2)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GP6 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDPLT11; GPIV; GPVI
Vector pCMV6-Entry
Sequence Data
>SC332283 representing NM_001256017.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTCCATCCCCGACCGCCCTCTTCTGTCTTGGGCTGTGTCTGGGGCGTGTGCCAGCGCAGAGTGGA
CCGCTCCCCAAGCCCTCCCTCCAGGCTCTGCCCAGCTCCCTGGTGCCCCTGGAGAAGCCAGTGACCCTC
CGGTGCCAGGGACCTCCGGGCGTGGACCTGTACCGCCTGGAGAAGCTGAGTTCCAGCAGGTACCAGGAT
CAGGCAGTCCTCTTCATCCCGGCCATGAAGAGAAGTCTGGCTGGACGCTACCGCTGCTCCTACCAGAAC
GGAAGCCTCTGGTCCCTGCCCAGCGACCAGCTGGAGCTCGTTGCCACGGGAGTTTTTGCCAAACCCTCG
CTCTCAGCCCAGCCCGGCCCGGCGGTGTCGTCAGGAGGGGACGTAACCCTACAGTGTCAGACTCGGTAT
GGCTTTGACCAATTTGCTCTGTACAAGGAAGGGGACCCTGCGCCCTACAAGAATCCCGAGAGATGGTAC
AGGGCTAGTTTTCCCATCATCACGGTGACCGCCGCCCACAGCGGAACCTACCGATGCTACAGCTTCTCC
AGCAGGGACCCATACCTGTGGTCAGCCCCCAGCGACCCCCTGGAGCTTGTGGTCACAGAATTCTCAGAA
GCCACCGCTGAACTGACCGTCTCATTCACAAACGAAGTCTTCACAACTGAGACTTCTAGGAGTATCACC
GCCAGTCCAAAGGAGTCAGACTCTCCAGCTGGTCCTGCCCGCCAGTACTACACCAAGGGCAACCTGGTC
CGGATATGCCTCGGGGCTGTGATCCTAATAATCCTGGCGGGGTTTCTGGCAGAGGACTGGCACAGCCGG
AGGAAGCGCCTGCGGCACAGGGGCAGGGCTGTGCAGAGGCCGCTTCCGCCCCTCCCGCCCCTCCCGCTG
ACCCGGAAATCAAACGGGGGTCAGGATGGAGGCCGACAGGATGTTCACAGCCGCGGGTTATGTTCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256017
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256017.2
RefSeq Size 2210 bp
RefSeq ORF 966 bp
Locus ID 51206
UniProt ID Q9HCN6
Protein Families Druggable Genome, Transmembrane
Protein Pathways ECM-receptor interaction
MW 35.1 kDa
Gene Summary This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) lacks an exon and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 3 which has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...