B7H4 (VTCN1) (NM_001253849) Human Untagged Clone
CAT#: SC332241
VTCN1 (untagged) - Homo sapiens V-set domain containing T cell activation inhibitor 1 (VTCN1), transcript variant 2
CNY 2640.00
CNY 2950.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | B7-H4; B7h.5; B7H4; B7S1; B7X; PRO1291; VCTN1 |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001253849, the custom clone sequence may differ by one or more nucleotides
ATGTTCAGAGGCCGGACAGCAGTGTTTGCTGATCAAGTGATAGTTGGCAATGCCTCTTTGCGGCTGAAAA ACGTGCAACTCACAGATGCTGGCACCTACAAATGTTATATCATCACTTCTAAAGGCAAGGGGAATGCTAA CCTTGAGTATAAAACTGGAGCCTTCAGCATGCCGGAAGTGAATGTGGACTATAATGCCAGCTCAGAGACC TTGCGGTGTGAGGCTCCCCGATGGTTCCCCCAGCCCACAGTGGTCTGGGCATCCCAAGTTGACCAGGGAG CCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGGTTGTGTC TGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAAAGCAACA GGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCAAAGGCTT CTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGATGCTAAA ATAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001253849 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001253849.1, NP_001240778.1 |
| RefSeq Size | 2734 bp |
| RefSeq ORF | 564 bp |
| Locus ID | 79679 |
| UniProt ID | Q7Z7D3 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) differs in the 5' UTR and coding region and uses a downstream start codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC233390 | VTCN1 (Myc-DDK tagged) - Homo sapiens V-set domain containing T cell activation inhibitor 1 (VTCN1), transcript variant 2 |
CNY 3990.00 |
|
| RG233390 | VTCN1 (tGFP-tagged) - Homo sapiens V-set domain containing T cell activation inhibitor 1 (VTCN1), transcript variant 2 |
CNY 4370.00 |
