CEBP gamma (CEBPG) (NM_001252296) Human Untagged Clone

CAT#: SC332185

CEBPG (untagged) - Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG), transcript variant 2



  "NM_001252296" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CEBPG Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPE1BP; IG/EBP-1
Vector pCMV6-Entry
Sequence Data
>SC332185 representing NM_001252296.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCAAGATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCA
CATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTG
GCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGA
GAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAG
AGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTA
AGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACT
GAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001252296
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252296.1
RefSeq Size 3647 bp
RefSeq ORF 453 bp
Locus ID 1054
UniProt ID P53567
Protein Families Druggable Genome, Transcription Factors
MW 16.4 kDa
Gene Summary The C/EBP family of transcription factors regulates viral and cellular CCAAT/enhancer element-mediated transcription. C/EBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. The C/EBP family consist of several related proteins, C/EBP alpha, C/EBP beta, C/EBP gamma, and C/EBP delta, that form homodimers and that form heterodimers with each other. CCAAT/enhancer binding protein gamma may cooperate with Fos to bind PRE-I enhancer elements. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...