USP4 (NM_001251877) Human Untagged Clone

CAT#: SC332140

USP4 (untagged) - Homo sapiens ubiquitin specific peptidase 4 (proto-oncogene) (USP4), transcript variant 3



  "NM_001251877" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-USP4 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UNP; Unph
Vector pCMV6-Entry
Sequence Data
>SC332140 representing NM_001251877.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAAGGTGGAGGCTGCCGTGAGCGACCGGATGCGGAGACTCAGAAGTCCGAGCTTGGACCCTTA
ATGAGGACCACACTCCAACGCGGGGCGCAGTGGTATCTTATTGACAGCCGGTGGTTCAAGCAGTGGAAG
AAGTATGTGGGCTTTGACAGCTGGGACATGTACAATGTGGGTGAACATAACCTATTTCCTGGCCCAATA
GACAACTCTGGGCTATTTTCAGATCCTGAGAGTCAGACCTTGAAAGAACACTTAATTGATGAATTGGAC
TATGTATTGGTCCCTACCGAGGCGTGGAATAAACTACTAAACTGGTACGGCTGTGTAGAAGGCCAGCAA
CCCATCGTCAGAAAAGTTGTGGAGCATGGCCTGTTTGTCAAGCACTGCAAAGTCGAGGTGTATTTGCTG
GAACTGAAGCTCTGTGAGAACAGTGACCCCACCAATGTGCTGAGTTGCCATTTCAGCAAGGCAGACACC
ATTGCAACCATCGAGAAAGAGATGCGGAAGCTATTCAACATCCCTGCGGAGCGTGAAACACGGCTCTGG
AACAAATACATGAGCAACACCTACGAGCAGTTGAGCAAGCTAGACAACACTGTCCAGGATGCTGGGCTA
TACCAGGGTCAGGTGCTAGTAATTGAGCCTCAAAATGAAGATGGCACATGGCCCAGGCAGACCTTGCAG
TCAAAAGTTTCGTTCTTTTTGCCCAGGCTGGAGTGCAATGGCGCGATCTTGGCTCACTGCAACTTCTGC
CTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCTTCCCGAGTAGCGCCATCACATCTGGCTAATTTTTTT
TTTTTTGAGATGGAGTCTCACTCTGTCACCAAGCTGGAGTGCGGTGGTGCAGTCTCGGCTTACTCCCGG
GTTCAAGTGATGCTTCTGCCCCAGCCTCCCGAGTGGCTGGGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001251877
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001251877.1
RefSeq Size 1673 bp
RefSeq ORF 942 bp
Locus ID 7375
UniProt ID Q13107
Protein Families Druggable Genome, Protease
MW 35.7 kDa
Gene Summary The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform c, which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...