Oct-2 (POU2F2) (NM_001247994) Human Untagged Clone

CAT#: SC332120

POU2F2 (untagged) - Homo sapiens POU class 2 homeobox 2 (POU2F2), transcript variant 4



  "NM_001247994" in other vectors (2)

CNY 3800.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-POU2F2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Oct-2; OCT2; OTF2
Vector pCMV6-Entry
Sequence Data
>SC332120 representing NM_001247994.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTTCACTCCAGCATGGGGGCTCCAGAAATAAGAATGTCTAAGCCCCTGGAGGCCGAGAAGCAAGGT
CTGGACTCCCCATCAGAGCACACAGACACCGAAAGAAATGGACCAGACACTAATCATCAGAACCCCCAA
AATAAGACCTCCCCATTCTCCGTGTCCCCAACTGGCCCCAGTACAAAGATCAAGGCTGAAGACCCCAGT
GGCGATTCAGCCCCAGCAGCACCCCTGCCCCCTCAGCCGGCCCAGCCTCATCTGCCCCAGGCCCAACTC
ATGTTGACGGGCAGCCAGCTAGCTGGGGACATACAGCAGCTCCTCCAGCTCCAGCAGCTGGTGCTTGTG
CCAGGCCACCACCTCCAGCCACCTGCTCAGTTCCTGCTACCGCAGGCCCAGCAGAGCCAGCCAGGCCTG
CTACCGACACCAAATCTATTCCAGCTACCTCAGCAAACCCAGGGAGCTCTTCTGACCTCCCAGCCCCGG
GCCGGGCTTCCCACACAGCCCCCCAAATGCTTGGAGCCACCATCCCACCCCGAGGAGCCCAGTGATCTG
GAGGAGCTGGAGCAATTCGCCCGCACCTTCAAGCAACGCCGCATCAAGCTGGGCTTCACGCAGGGTGAT
GTGGGCCTGGCCATGGGCAAGCTCTACGGCAACGACTTCAGCCAGACGACCATTTCCCGCTTCGAGGCC
CTCAACCTGAGCTTCAAGAACATGTGCAAACTCAAGCCCCTCCTGGAGAAGTGGCTCAACGATGCAGAG
ACTATGTCTGTGGACTCAAGCCTGCCCAGCCCCAACCAGCTGAGCAGCCCCAGCCTGGGTTTCGACGGC
CTGCCCGGCCGGAGACGCAAGAAGAGGACCAGCATCGAGACAAACGTCCGCTTCGCCTTAGAGAAGAGT
TTTCTAGCGAACCAGAAGCCTACCTCAGAGGAGATCCTGCTGATCGCCGAGCAGCTGCACATGGAGAAG
GAAGTGATCCGCGTCTGGTTCTGCAACCGGCGCCAGAAGGAGAAACGCATCAACCCCTGCAGTGCGGCC
CCCATGCTGCCCAGCCCAGGGAAGCCGGCCAGCTACAGCCCCCATATGGTCACACCCCAAGGGGGCGCG
GGGACCTTACCGTTGTCCCAAGCTTCCAGCAGTCTGAGCACAACAGCACAAACCCCAGCCCTCAAGGCA
GCCACTCGGCTATCGGCTTGTCAGGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001247994
Insert Size 1203 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001247994.1
RefSeq Size 6768 bp
RefSeq ORF 1203 bp
Locus ID 5452
UniProt ID P09086
Protein Families Transcription Factors
MW 43.5 kDa
Gene Summary The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) uses alternate splice junctions at the 5' ends of two exons compared to variant 1, the 5'-most being in-frame and the 3'-most causing a frameshift. The resulting isoform (4) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...