NFIC (NM_001245005) Human Untagged Clone

CAT#: SC332116

NFIC (untagged) - Homo sapiens nuclear factor I/C (CCAAT-binding transcription factor) (NFIC), transcript variant 4



  "NM_001245005" in other vectors (2)

CNY 4090.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-NFIC Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CTF; CTF5; NF-I; NFI
Vector pCMV6-Entry
Sequence Data
>SC332116 representing NM_001245005.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGAGTTCCACCCGTTCATCGAGGCCCTGCTGCCTCACGTCCGCGCCTTCGCCTACACCTGGTTC
AACCTGCAGGCGCGGAAGCGCAAGTACTTCAAGAAGCACGAGAAGCGGATGTCGAAGGACGAGGAGCGT
GCGGTCAAGGACGAGCTGCTGGGCGAGAAGCCCGAGGTCAAGCAGAAGTGGGCGTCGCGGCTGCTGGCC
AAGCTGCGCAAGGACATCCGGCCCGAGTGCCGCGAGGACTTCGTGCTGAGCATCACCGGCAAGAAGGCG
CCGGGCTGCGTGCTCTCCAACCCCGACCAGAAGGGCAAGATGCGGCGCATCGACTGTCTCCGGCAGGCG
GACAAGGTGTGGCGGCTGGACCTGGTCATGGTCATCCTGTTCAAGGGCATCCCGCTGGAGAGCACCGAC
GGCGAGCGCCTGGTCAAGGCTGCGCAGTGCGGTCACCCGGTCCTGTGCGTGCAGCCGCACCACATTGGC
GTGGCCGTCAAGGAGCTGGACCTCTACCTGGCCTACTTCGTGCGTGAGCGAGATGCAGAGCAAAGCGGC
AGTCCCCGGACAGGGATGGGCTCTGACCAGGAGGACAGCAAGCCCATCACGCTGGACACGACCGACTTC
CAGGAGAGCTTTGTCACCTCCGGCGTGTTCAGCGTCACTGAGCTCATCCAAGTGTCCCGGACACCCGTG
GTGACTGGAACAGGACCCAACTTCTCCCTGGGGGAGCTGCAGGGGCACCTGGCATACGACCTGAACCCA
GCCAGCACTGGCCTCAGAAGAACGCTGCCCAGCACCTCCTCCAGTGGGAGCAAGCGGCACAAATCGGGC
TCGATGGAGGAAGACGTGGACACGAGCCCTGGCGGCGATTACTACACTTCGCCCAGCTCGCCCACGAGT
AGCAGCCGCAACTGGACGGAGGACATGGAAGGAGGCATCTCGTCCCCGGTGAAGAAGACAGAGATGGAC
AAGTCACCATTCAACAGCCCGTCCCCCCAGGACTCTCCCCGCCTCTCCAGCTTCACCCAGCACCACCGG
CCCGTCATCGCCGTGCACAGCGGGATCGCCCGGAGCCCACACCCGTCCTCCGCTCTGCATTTCCCTACG
ACGTCCATCCTACCCCAGACGGCCTCCACCTACTTCCCCCACACGGCCATCCGCTACCCACCTCATCTC
AACCCCCAGGACCCGCTCAAAGATCTTGTCTCGCTGGCCTGCGACCCAGCCAGCCAGCAACCTGGACCG
CCTACTCTCCGCCCGACACGTCCCCTGCAAACCGTTCCTTTGTGGGATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001245005
Insert Size 1293 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001245005.1
RefSeq Size 7932 bp
RefSeq ORF 1293 bp
Locus ID 4782
UniProt ID P08651
Protein Families Transcription Factors
MW 47.9 kDa
Gene Summary The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) contains an alternate 5' terminal exon, and lacks an exon in the 3' coding region (causing a frame-shift) compared to variant 1. This results in translation initiation from an alternate start codon, and a shorter isoform (4) with distinct N- and C- termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...