Keratinocyte differentiation associated protein (KRTDAP) (NM_001244847) Human Untagged Clone

CAT#: SC332098

KRTDAP (untagged) - Homo sapiens keratinocyte differentiation-associated protein (KRTDAP), transcript variant 2



  "NM_001244847" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KDAP; UNQ467
Vector pCMV6-Entry
Sequence Data
>SC332098 representing NM_001244847.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGATCCCGGTCCTTCCTGCCGTGGTGCTCCTCTCCCTCCTGGTGCTCCACTCTGCCCAGGGAGCC
ACCCTGGGTGGTCCTGAGGAAGAAAGCACCATTGAGAATTATGCGTCACGACCCGAGGCGTTTAAGGCT
GATGAGTTCCTGAACTGGCACGCCCTCTTTGAGTCTATCAAAAGGAAACTTCCTTTCCTCAACTGGGAT
GCCTTTCCTAAGCTGAAAGGACTGAGGAGCGCAACTCCTGATGCCCAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244847
Insert Size 258 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244847.1
RefSeq Size 458 bp
RefSeq ORF 258 bp
Locus ID 388533
UniProt ID P60985
MW 9.4 kDa
Gene Summary This gene encodes a protein which may function in the regulation of keratinocyte differentiation and maintenance of stratified epithelia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Keratinocyte differentiation associated protein产品

Customer Reviews 
Loading...