Keratinocyte differentiation associated protein (KRTDAP) (NM_001244847) Human Untagged Clone
CAT#: SC332098
KRTDAP (untagged) - Homo sapiens keratinocyte differentiation-associated protein (KRTDAP), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KDAP; UNQ467 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332098 representing NM_001244847.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGATCCCGGTCCTTCCTGCCGTGGTGCTCCTCTCCCTCCTGGTGCTCCACTCTGCCCAGGGAGCC ACCCTGGGTGGTCCTGAGGAAGAAAGCACCATTGAGAATTATGCGTCACGACCCGAGGCGTTTAAGGCT GATGAGTTCCTGAACTGGCACGCCCTCTTTGAGTCTATCAAAAGGAAACTTCCTTTCCTCAACTGGGAT GCCTTTCCTAAGCTGAAAGGACTGAGGAGCGCAACTCCTGATGCCCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244847 |
Insert Size | 258 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001244847.1 |
RefSeq Size | 458 bp |
RefSeq ORF | 258 bp |
Locus ID | 388533 |
UniProt ID | P60985 |
MW | 9.4 kDa |
Gene Summary | This gene encodes a protein which may function in the regulation of keratinocyte differentiation and maintenance of stratified epithelia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233244 | KRTDAP (Myc-DDK tagged) - Homo sapiens keratinocyte differentiation-associated protein (KRTDAP), transcript variant 2 |
CNY 3990.00 |
|
RG233244 | KRTDAP (tGFP-tagged) - Homo sapiens keratinocyte differentiation-associated protein (KRTDAP), transcript variant 2 |
CNY 4370.00 |
其它Keratinocyte differentiation associated protein产品