PARVB (NM_001243386) Human Untagged Clone

CAT#: SC331998

PARVB (untagged) - Homo sapiens parvin, beta (PARVB), transcript variant 4



  "NM_001243386" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PARVB mouse monoclonal antibody,clone OTI1B7
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-56
Vector pCMV6-Entry
Sequence Data
>SC331998 representing NM_001243386.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCCCGCCCTGGTGGATGTTCACCCTGAAGACACCCAGCTTGAGGAGAACGAGGAGCGCACGATG
ATTGACCCCACTTCCAAGGAAGACCCCAAGTTCAAGGAACTGGTCAAGGTCCTCCTCGACTGGATTAAT
GACGTGCTGGTGGAGGAGAGGATCATTGTGAAGCAGCTGGAGGAAGACCTGTATGACGGCCAGGTGCTG
CAGAAGCTCTTGGAAAAACTGGCAGGGTGCAAGCTGAATGTGGCTGAGGTGACACAGTCCGAAATAGGG
CAGAAACAGAAGCTGCAGACGGTGCTGGAAGCAGTACATGACCTGCTGCGGCCCCGAGGCTGGGCGCTC
CGGTGGAGCGTGGACTCAATTCACGGGAAGAACCTGGTGGCCATCCTCCACCTGCTGGTCTCTCTGGCC
ATGCACTTCAGGGCCCCCATCCGCCTTCCTGAGCATGTAACGGTGCAGGTGGTGGTCGTGCGGAAACGG
GAAGGCCTGCTGCATTCCAGCCACATCTCGGAGGAGCTGACCACAACTACAGAGATGATGATGGGCCGG
TTCGAGCGGGATGCCTTCGACACGCTGTTCGACCACGCCCCGGATAAGCTCAGCGTGGTGAAGAAGTTT
GCAGATGGCGTGTACCTGGTTCTGCTCATGGGCCTTCTGGAAGACTACTTTGTTCCTCTCCACCACTTC
TACCTGACTCCGGAAAGCTTCGATCAGAAGGTCCACAATGTGTCCTTCGCCTTTGAGCTGATGCTGGAC
GGAGGCCTCAAGAAACCCAAGGCTCGTCCTGAAGACGTGGTTAACTTGGACCTCAAATCCACCCTGAGG
GTTCTTTACAACCTGTTCACCAAGTACAAGAACGTGGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243386
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243386.1
RefSeq Size 1554 bp
RefSeq ORF 870 bp
Locus ID 29780
UniProt ID Q9HBI1
Protein Pathways Focal adhesion
MW 33.3 kDa
Gene Summary This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, uses a downstream alternate start codon, and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (d) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...