IKB beta (NFKBIB) (NM_001243116) Human Untagged Clone
CAT#: SC331948
NFKBIB (untagged) - Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IKBB; TRIP9 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331948 representing NM_001243116.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACCTGCAGAATGACCTAGGCCAGACAGCCCTGCACCTGGCAGCCATCCTGGGGGAGACATCCACG GTGGAGAAGCTGTACGCAGCAGGCGCCGGGCTGTGTGTGGCGGAGCGTAGGGGCCACACGGCGCTGCAC CTGGCCTGCCGTGTGGGGGCACACGCCTGTGCCCGTGCCCTGCTTCAGCCCCGCCCCCGGCGCCCCAGG GAAGCCCCCGACACCTACCTCGCTCAGGGCCCTGACCGTACTCCCGACACCAACCATACCCCTGTCGCC TTGTACCCCGATTCCGACTTGGAGAAGGAAGAAGAGGAGAGTGAGGAGGACTGGAAGCTGCAGCTGGAG GCTGAAAACTACGAGGGCCACACCCCACTCCACGTGGCCGTTATCCACAAAGATGTGGAGATGGTCCGG CTGCTCCGAGATGCTGGAGCTGACCTTGACAAACCGGAGCCCACGTGCGGCCGGAGCCCCCTTCATTTG GCAGTGGAGGCCCAGGCAGCCGATGTGCTGGAGCTTCTCCTGAGGGCAGGCGCGAACCCTGCTGCCCGC ATGTACGGTGGCCGCACCCCACTCGGCAGTGCCATGCTCCGGCCCAACCCCATCCTCGCCCGCCTCCTC CGTGCACACGGAGCCCCTGAGCCCGAGGGCGAGGACGAGAAATCCGGCCCCTGCAGCAGCAGTAGCGAC AGCGACAGCGGAGACGAGGGCGATGAATACGACGACATTGTGGTTCACAGCAGCCGCAGCCAAACCCGG CTGCCTCCCACCCCAGCCTCAAAACCTCTTCCTGACGACCCCCGCCCCGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243116 |
Insert Size | 813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243116.1 |
RefSeq Size | 1001 bp |
RefSeq ORF | 813 bp |
Locus ID | 4793 |
UniProt ID | Q15653 |
Protein Families | Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Adipocytokine signaling pathway, B cell receptor signaling pathway, Chemokine signaling pathway, Cytosolic DNA-sensing pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway |
MW | 29.1 kDa |
Gene Summary | The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011] Transcript Variant: This variant (2) contains an alternate 5' terminal exon compared to variant 1. This results in translation initiation from an in-frame downstream AUG, and a shorter isoform (2) compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233601 | NFKBIB (Myc-DDK tagged) - Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2 |
CNY 3990.00 |
|
RG233601 | NFKBIB (tGFP-tagged) - Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2 |
CNY 4370.00 |
其它IKB beta产品