IF3EI (EIF3L) (NM_001242923) Human Untagged Clone

CAT#: SC331928

EIF3L (untagged) - Homo sapiens eukaryotic translation initiation factor 3, subunit L (EIF3L), transcript variant 2



  "NM_001242923" in other vectors (2)

CNY 5040.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
EIF3L Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EIF3EIP; EIF3S6IP; EIF3S11; HSPC021; HSPC025; MSTP005
Vector pCMV6-Entry
Sequence Data
>SC331928 representing NM_001242923.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTTATCCCGCTGATGATTATGAGTCTGAGGCGGCTTATGACCCCTACGCTTATCCCAGCGACTAT
GATATGCACACAGGAGATCCAAAGCAGGACCTTGCTTATGAACGTCAGTATGAACAGCAAACCTATCAG
GTGATCCCTGAGGTGATCAAAAACTTCATCCAGTATTTCCACAAAACTGTCTCAGATTTGATTGACCAG
AAAGTGTATGAGCTACAGGCCAGTCGTGTCTCCAGTGATGTCATTGACCAGAAGGTGTATGAGATCCAG
GACATCTATGAGAACAGCTGGACCAAGCTGACTGAAAGATTCTTCAAGAATACACCTTGGCCCGAGGCT
GAAGCCATTGCTCCACAGGTTGGCAATGATGCTGTCTTCCTGATTTTATACAAAGAATTATACTACAGG
CACATATATGCCAAAGTCAGTTTTCAGTCATTCAGTCAGTACCGCTGTAAGACTGCCAAGAAGTCAGAG
GAGGAGATTGACTTTCTTCGTTCCAATCCCAAAATCTGGAATGTTCATAGTGTCCTCAATGTCCTTCAT
TCCCTGGTAGACAAATCCAACATCAACCGACAGTTGGAGGTATACACAAGCGGAGGTGACCCTGAGAGT
GTGGCTGGGGAGTATGGGCGGCACTCCCTCTACAAAATGCTTGGTTACTTCAGCCTGGTCGGGCTTCTC
CGCCTGCACTCCCTGTTAGGAGATTACTACCAGGCCATCAAGGTGCTGGAGAACATCGAACTGAACAAG
AAGAGTATGTATTCCCGTGTGCCAGAGTGCCAGGTCACCACATACTATTATGTTGGGTTTGCATATTTG
ATGATGCGTCGTTACCAGGATGCCATCCGGGTCTTCGCCAACATCCTCCTCTACATCCAGAGGACCAAG
AGCATGTTCCAGAGGACCACGTACAAGTATGAGATGATTAACAAGCAGAATGAGCAGATGCATGCGCTG
CTGGCCATTGCCCTCACGATGTACCCCATGCGTATTGATGAGAGCATTCACCTCCAGCTGCGGGAGAAA
TATGGGGACAAGATGTTGCGCATGCAGAAAGGTGACCCACAAGTCTATGAAGAACTTTTCAGTTACTCC
TGCCCCAAGTTCCTGTCGCCTGTAGTGCCCAACTATGATAATGTGCACCCCAACTACCACAAAGAGCCC
TTCCTGCAGCAGCTGAAGGTGTTTTCTGATGAAGTACAGCAGCAGGCCCAGCTTTCAACCATCCGCAGC
TTCCTGAAGCTCTACACCACCATGCCTGTGGCCAAGCTGGCTGGCTTCCTGGACCTCACAGAGCAGGAG
TTCCGGATCCAGCTTCTTGTCTTCAAACACAAGATGAAGAACCTCGTGTGGACCAGCGGTATCTCAGCC
CTGGATGGTGAATTTCAGTCAGCCTCAGAGGTTGACTTCTACATTGATAAGGACATGATCCACATCGCG
GACACCAAGGTCGCCAGGCGTTATGGGGATTTCTTCATCCGTCAGATCCACAAATTTGAGGAGCTTAAT
CGAACCCTGAAGAAGATGGGACAGAGACCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242923
Insert Size 1551 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242923.1
RefSeq Size 1947 bp
RefSeq ORF 1551 bp
Locus ID 51386
UniProt ID Q9Y262
MW 61 kDa
Gene Summary Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks two consecutive exons in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...